Plukenetia volubilis

Description

Plukenetia volubilis is a perennial plant with somewhat hairy leaves in the Euphorbiaceae. It is native to the rain forest of South America. The plant reaches a height of 2m, with alternate, heart shaped, serrated leaves. It flowers five months after being planted, and bears seeds around the eighth month. Its seed oil is rich in polyunsaturated fatty acids (PUFAs) and lipovitamins, which has great potential economic value to the food and pharmaceutical industries. Moreover, its oil is also a good feedstock for biodiesel production^[1]^[2].
Common Name: Sacha inchi, Sacha peanut, Mountain peanut
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
UCE^[1]	Ubiquitin-conjugating enzyme	Flower and seed development Roots, stems, leaves, flowers, and seeds from adult plants Development of reproductive organs	NA	F:TGGAATGGATGACGGAGACGACAT R:AACACTTGGTGGCTTCTCTGGATAATC	142	78.74	SYBR
ACT^[1]	Actin	Flower and seed development Roots, stems, leaves, flowers, and seeds from adult plants Development of reproductive organs	NA	F:CCAGAAGTCTTGTTCCAGCCATCTC R:GCGGTGATCTCCTTGCTCATACG	140	80.66	SYBR
EF1α^[1]	Elongation factor 1-alpha	Flower and seed development Roots, stems, leaves, flowers, and seeds from adult plants Development of reproductive organs	NA	F:GGTATTCTCAAGCCTGGTATGGTTGT R:GAGAGCCTCCTGAAGAGCCTCAT	102	80.48	SYBR

Name: Zeng-Fu Xu
Email: zfxu@xtbg.ac.cn
Institution: School of Life Sciences, University of Science and Technology of China, Hefei 230027, China

Cited by 11 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Niu L, Tao YB, Chen MS, et al. (2015) Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR. Int J Mol Sci 16, 12513-12530.
↑ Gillespie LJ (2007) A revision of paleotropical Plukenetia (Euphorbiaceae) including two new species from Madagascar. Systematic Botany 32, 780-802.