Musa acuminata

From ICG
Jump to: navigation, search

Description

Musa acuminata.png
  • Musa acuminata is the second ranking fruit crop in the world, with an annual world production of 100 million metric tons. It is not only as a popular dessert fruit, but also as a source of vital carbohydrate. Cultivated bananas are giant herbaceous plants within the genus Musa, they are both sterile and parthenocarpic so the fruit develops without seed. The cultivated hybrids and species are mostly triploid, and most have been propagated from mutants found in the wild[1][2].
  • Common Name: Banana
  • NCBI Taxonomy

Different Experimental Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS2[1] Ribosomal protein S 2
  • In 144 banana samples
HQ853246
  • F:TAGGGATTCCGACGATTTGTTT
  • R:TAGCGTCATCATTGGCTGGGA
84 80.86 SYBR
UBQ2[1] Ubiquitin2
  • In 145 banana samples
HQ853254
  • F:GGCACCACAAACAACACAGG
  • R:AGACGAGCAAGGCTTCCATT
379 85.58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jian-ye Chen
  • Email: chenjianye@scau.edu.cn
  • Institution: Guangdong Key Laboratory for Postharvest Science, College of Horticultural Science, South China Agricultural University, Guangzhou 510642, People’s Republic of China

Citation Statistics

Cited by 161 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Chen L, Zhong H, Kuang J, et al. Validation of reference genes for RT-qPCR studies of gene expression in banana fruit under different experimental conditions[J]. Planta, 2011, 234(2): 377.
  2. J. S. Heslop-Harrison,Trude Schwarzacher. Domestication, Genomics and the Future for Banana. Ann Bot. 2007 Oct; 100(5): 1073–1084. Published online 2007 Aug 31. doi: 10.1093/aob/mcm191.

Categories