Musca domestica

From ICG
Jump to: navigation, search

Description

Musca domestica.png
  • M. domestica, the common house fly, has a complete metamorphosis with distinct egg, larva or maggot, pupal, and adult stages and is known to be a vector of many human and animal pathogens. In humans and animals, many diseases including typhoid, cholera, bacillary dysentery, tuberculosis, anthrax ophthalmia, infantile diarrhea, and parasitic worms are caused by more than 100 pathogens that have been associated with M. domestica. Because of its remarkable immune defenses, M. domestica is capable of living with such pathogens without any ill effects[1][2][3].
  • Common Name: Housefly
  • NCBI Taxonomy

Abiotic & Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase-like
  • Injury and bacterial challenge for third instar larvae
  • Egg, first, second and third instar larvae, early and late pupae, and adults
JX427558
  • F:GACAACTACTCACTCTTACACCG
  • R:GTTCGGGAGGACAAGGGAAA
150 60 SYBR
EF1a[1] Elongation factor 1 alpha-like
  • Injury and bacterial challenge for third instar larvae
  • Egg, first, second and third instar larvae, early and late pupae, and adults
JX427558
  • F:CCATACCAGCATCACCATTCTTC
  • R:GTCACACTTCCCACATTGCC
117 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jifang Wen
  • Email: jifangw@yahoo.com
  • Institution: Department of Pathology, School of Basic Medical Sciences, Central South University, Changsha 410013, China

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Zhong M, Wang X, Wen J, et al. Selection of reference genes for quantitative gene expression studies in the house fly (Musca domestica L.) using reverse transcription quantitative real-time PCR[J]. Acta Biochim Biophys Sin, 2013, 45(12): 1069.
  2. Pavela R. Insecticidal properties of several essential oils on the house fly (Musca domestica L.). Phytother Res 2008, 22: 274–278.
  3. Naitza S and Ligoxygakis P. Antimicrobial defences in Drosophila: the story so far. Mol Immunol 2004, 40: 887–896.

Categories