Neurospora crassa

From ICG
Jump to: navigation, search

Description

Neurospora crassa.png
  • Neurospora crassa is a filamentous fungus classified under the phylum Ascomycota and is widely distributed in nature. It is typically found growing on vegetation killed by fire because it is able to synthesize and secrete high levels of enzyme types involved in lignocellulosic biomass degradation. It is also able to convert pentose sugars, cellulose polymers, and agro-industrial residues to ethanol. It has served as a model organism for studying circadian pathways and has gained attention from the biofuel industry due to its enhanced capacity for cellulase production[1][2].
  • Common Name: NA
  • NCBI Taxonomy

Different Environmental Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
btl[1] Beta-tubulin
  • Light/dark cycling, all-dark growth, temperature flux
NCU04054
  • F:CCACTTCTTCATGGTCGGCT
  • R:CTTGGGGTCGAACATCTGCT
103 83.21 SYBR
asl[1] ATP synthase lyase gamma subunit
  • Light/dark cycling, temperature flux
NCU09119.7
  • F:TACCAACGCCAAGGACATCG
  • R:GAGTAGTCGCCCTTGAGCTG
114 81.35 SYBR
vma1[1] Vacuolar ATPase subunit 1
  • Light/dark cycling, all-dark growth, temperature flux
J03955.1
  • F:CCAACAAAATGGCGCCGAG
  • R:CCAACTCATACATAGCAACACC
111 80.45 SYBR
tbp[1] TATA binding box protein
  • All-dark growth
NCU044770
  • F:GGTGCCAAGTCCGAAGATGA
  • R:TGGGGAACTTGATGTCGCAA
136 79.38 SYBR
vma2[1] Vacuolar ATPase subunit 2
  • All-dark growth
J03956.1
  • F:GTCGTCCAGGTCTTCGAGG
  • R:TGCCGGAACCATCAAAGATACG
127 78.90 SYBR
ACT[1] Beta-actin
  • Different temperature conditions
NCU04173
  • F:GATCGGTATGGGCCAGAAGG
  • R:CGTCCCAGTTGGTAACGACA
110 79.10 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kathleen D. Cusick
  • Email: Kathleen_cusick.ctr@code6100.nrl.navy.mil
  • Institution: National Research Council Associateship, U.S. Naval Research Laboratory, Washington, District of Columbia, United States of America

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Cusick KD, Fitzgerald LA, Pirlo RK, et al. (2014) Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture. PLoS One 9, e112706
  2. Baker CL, Loros JJ, Dunlap JC (2012) The circadian clock of Neurospora crassa. Fems Microbiology Reviews 36, 95-110.

Categories