Nicotiana tabacum

From ICG
Jump to: navigation, search

Description

Nicotiana tabacum.png
  • Nicotiana tabacum is one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries. It is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production. It is also an important model in studies of plant gene expression which is generally robust, the nuclear and chloroplast genomes are readily transformed[1][2] .
  • Common Name: Tobacco
  • NCBI Taxonomy

Different Developmental Stages & Abiotic stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
L25[1] L25 ribosomal protein
  • Leaf, stem, root, anther and carpel
  • Heat, cold, cold, drought, UV irradiation
L18908
  • F:CCCCTCACCACAGAGTCTGC
  • R:AAGGGTGTTGTTGTCCTCAATCTT
NA 60 SYBR
EF-1α[1] Elongation factor 1α
  • Leaf, stem, root, anther and carpel
  • Heat, cold, cold, drought, UV irradiation
AF120093
  • F:TGAGATGCACCACGAAGCTC
  • R:CCAACATTGTCACCAGGAAGTG
NA 67 SYBR
Ntubc2[1] Ubiquitin-conjugating enzyme E2
  • Leaf, stem, root, anther and carpel
  • Heat, cold, cold, drought, UV irradiation
AB026056
  • F:CTGGACAGCAGACTGACATC
  • R:CAGGATAATTTGCTGTAACAGATTA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sven K. Delaney
  • Email: s.delaney@unsw.edu.au
  • Institution: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia

Citation Statistics

Cited by 217 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241.
  2. Xing X, Li X, Zhang M, et al. Transcriptome analysis of resistant and susceptible tobacco (Nicotiana tabacum) in response to root-knot nematode Meloidogyne incognita infection[J]. Biochemical and Biophysical Research Communications, 2017, 482(4): 1114-1121.

Categories