Nilaparvata lugens

From ICG
Jump to: navigation, search

Description

Brown Planthopper.png
  • Nilaparvata lugens is a major pest to rice production in many areas of Asia. It shows two wing forms, long (macropterous) and short (brachypterous) ones, in its adult stage. The macropterous adults possess the ability to migrate across long distances, while the brachypterous adults exemplify strong reproductive capacities. It ingests nutrients of rice and causes diseases in rice by being vector of viruses. In recent years, N. lugens outbreaks have occurred more frequently in the South of China. Because of its long-distance migration, quick adaptation to resistant rice varieties and development of high resistance to pesticides, N. lugens infestations are difficult to control[1][2].
  • Common Name: Brown Planthopper
  • NCBI Taxonomy

Different Experimental Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS15[1] Ribosomal protein S15
  • Different developmental stages, body parts & geographic populations
  • Different temperature and diet conditions
FJ810193
  • F:TAAAAATGGCAGACGAAGAGCCCAA
  • R:TTCCACGGTTGAAACGTCTGCG
150 60 EvaGreen
RPS11[1] Ribosomal protein S11
  • Different developmental stages, body parts & geographic populations
  • Different temperature and diet conditions
FJ810197
  • F:CCGATCGTGTGGCGTTGAAGGG
  • R:ATGGCCGACATTCTTCCAGGTCC
159 60 EvaGreen
TUB[1] A-tubulin
  • Different developmental stages, body parts, and geographic populations
FJ810204
  • F:ACTCGTTCGGAGGAGGCACC
  • R:GTTCCAGGGTGGTGTGGGTGGT
174 60 EvaGreen

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jianhong Li
  • Email: jianhl@mail.hzau.edu.cn
  • Institution: Laboratory of Pesticide, College of Plant Science & Technology, Huazhong Agricultural University, Wuhan, China

Citation Statistics

Cited by 56 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Yuan M, Lu YH, Zhu X, et al. (2014) Selection and Evaluation of Potential Reference Genes for Gene Expression Analysis in the Brown Planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) Using Reverse-Transcription Quantitative PCR. PLoS One 9.
  2. Dong XL, Zhai YF, Zhang JQ, et al. (2011) Fork head transcription factor is required for ovarian mature in the brown planthopper, Nilaparvata lugens (Stal). Bmc Molecular Biology 12.

Categories