Octopus vulgaris

From ICG
Jump to: navigation, search

Description

Octopus vulgaris.png
  • Octopus vulgaris is the most important octopus species in worldwide fisheries and represents a major protein resource in most fish-eating countries. It is of great commercial importance in Mediterranean, South American and Asian countries as well as in the NW Atlantic coasts of Spain and Portugal[1][2].
  • Common Name: Common octopus
  • NCBI Taxonomy

Brain

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ubi[1] Ubiquitin
  • Brain
FJ617440
  • F:TCAAAACCGCCAACTTAACC
  • R:CCTTCATTTGGTCCTTCGTC
113 60 SYBR
tubA[1] α-tubulin
  • Brain
X15845
  • F:ACTGGTGTCCAACTGGCTTC
  • R:TGCTTAACATGCACACAGCA
105 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Graziano Fiorito
  • Email: gfiorito@szn.it
  • Institution: Laboratorio di Neurobiologia, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy

Citation Statistics

Cited by 20 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Sirakov M, Zarrella I, Borra M, Rizzo F, Biffali E, Arnone MI, Fiorito G. Selection and validation of a set of reliable reference genes for quantitative RT-PCR studies in the brain of the Cephalopod Mollusc Octopus vulgaris. BMC Mol Biol. 2009 Jul 14;10:70. doi: 10.1186/1471-2199-10-70. PubMed PMID: 19602224; PubMed Central PMCID: PMC2722649.
  2. Castellanos-Martínez S, Arteta D, Catarino S, Gestal C. De novo transcriptome sequencing of the Octopus vulgaris hemocytes using Illumina RNA-Seq technology: response to the infection by the gastrointestinal parasite Aggregata octopiana. PLoS One. 2014 Oct 16;9(10):e107873. doi: 10.1371/journal.pone.0107873. eCollection 2014. PubMed PMID: 25329466; PubMed Central PMCID: PMC4199593.

Categories