Oryctolagus cuniculus

From ICG
Jump to: navigation, search

Description

Oryctolagus cuniculus.png
  • Oryctolagus cuniculus is wildly spread in the world, it is a kind of small mammals in the family of the order Lagomorpha. The Lagomorpha family consists of eight different genera in the family classified as rabbits, including the European rabbit, cottontail rabbits, and the Amami rabbit. There are many other species of rabbit, and these, along with pikas and hares, make up the order Lagomorpha. Rabbits live in groups, underground burrows, or rabbit holes and feed by grazing on grass, forbs, and leafy weeds[1][2] .
  • Common Name: Rabbit
  • NCBI Taxonomy

Cartilage Tissue Injury & Repair

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
B2M[1] β-2-microglobulin
  • Cartilage tissues
XM_002717921.1
  • F:AACGTGGAACAGTCAGACC
  • R:AGTAATCTCGATCCCATTTC
157 60 SYBR
18S rRNA[1] 18S Ribosomal RNA
  • Cartilage tissues
NR_033238.1
  • F:ATCAGATACCGTCGTAGTTC
  • R:TTCCGTCAATTCCTTTAAG
167 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiao-Xiang Peng
  • Email: pxx74@sina.com
  • Institution: Shandong Provincial Key Laboratory of Clinical Laboratory Diagnostics, Department of Medical Laboratory, Weifang Medical University, Shandong 261053, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Peng X X, Zhao R L, Song W, et al. Selection of suitable reference genes for normalization of quantitative real-time PCR in cartilage tissue injury and repair in rabbits[J]. International journal of molecular sciences, 2012, 13(11): 14344-14355.
  2. Fedriani, J. M.; Palomares, F.; Delibes, M. (1999). "Niche relations among three sympatric Mediterranean carnivores" (PDF). Oecologia. 121: 138–148. doi:10.1007/s004420050915. JSTOR 4222449.

Categories