Ovis aries

From ICG
Jump to: navigation, search

Description

Ovis aries.png
  • Ovis aries is a member of the order Artiodactyla, the even-toed ungulates. It is a quadrupedal, ruminant mammal typically kept as livestock. Although the name "sheep" applies to many species in the genus Ovis, in everyday usage it almost always refers to Ovis aries. Domestic sheep are also the most numerous species of sheep. An adult female sheep is referred to as a ewe, an intact male as a ram or occasionally a tup, a castrated male as a wether, and a younger sheep as a lamb[1] [2].
  • Common Name: Sheep
  • NCBI Taxonomy

Preterm Lamb Model

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Lung injury in preterm lamb model
NM_001190390
  • F:GGCCTCCAAGGAGTAAGGTC
  • R:TCTCTTCCTCTCGTGCTCCT
60 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Prue M. Pereira-Fantini
  • Email: prue.pereira@mcri.edu.au
  • Institution: Neonatal Research Group, Murdoch Childrens Research Institute, Parkville, Australia.

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Pereira-Fantini PM, Rajapaksa AE, Oakley R, Tingay DG (2016) Selection of Reference Genes for Gene Expression Studies related to lung injury in a preterm lamb model. Sci Rep 6, 26476.
  2. Zedda M, Palombo MR, Brits D, et al. (2016) Differences in femoral morphology between sheep (Ovis aries) and goat (Capra hircus): macroscopic and microscopic observations. Zoomorphology 136, 145-158.

Categories