Oxytropis ochrocephala

From ICG
Jump to: navigation, search

Description

Oxytropis ochrocephala.png
  • Oxytropis ochrocephala Bunge is a perennial grass species. It is the most widespread locoweed that grows aggressively on the grassland in China and poses great threats to livestock. Locoweeds contain an indolizidine alkaloid swainsonine, an α-mannosidase inhibitor which causes over-accumulation of mannose rich oligosaccharide in the lysosomes and impairs the neural system of livestock, which has long been recognized as the principle for intoxication in animals. There is a need for further genetic study in the plants for understanding the basis of its acclimation mechanism in various unfavorable environmental conditions and to implement effective control measures[1] [2].
  • Common Name: Huang hua ji dou
  • NCBI Taxonomy

Abiotic Stress Treatments

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HIS[1] Histone H3
  • Drought, cold and salt stress
  • Seedlings
KR733680
  • F:ATGGGCTTGGTGCTGTTA
  • R:CCTTCATCAGACTAGCAGTAAAC
95 60 SYBR
ACT7[1] Actin-7
  • Drought, cold and salt stress
  • Seedlings
KR822227
  • F:CTCCACCAGAGAGAAAGTACAGT
  • R:CCCAGAATATACCCTCCGAT
266 60 SYBR
ACT101[1] Actin 101
  • Drought, cold and salt stress
  • Seedlings
KR822225
  • F:GGGTGAATATGATGAATCTGG
  • R:GTCTGGCTTTCAAGGACATAA
232 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yahui Wei
  • Email: weiyahui@nwu.edu.cn
  • Institution: Key Laboratory of Resource Biology and Biotechnology in Western China, Department of Life Science, Northwest University, Xi’an, China

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Zhuang H, Fu Y, He W, Wang L, Wei Y (2015) Selection of appropriate reference genes for quantitative real-time PCR in Oxytropis ochrocephala Bunge using transcriptome datasets under abiotic stress treatments. Front Plant Sci 6, 475.
  2. Ralphs MH, Creamer R, Baucom D, et al. (2008) Relationship between the endophyte Embellisia spp. and the toxic alkaloid swainsonine in major locoweed species (Astragalus and Oxytropis). J Chem Ecol 34, 32-38.

Categories