Paeonia suffruticosa

From ICG
Jump to: navigation, search

Description

Paeonia suffruticosa.png
  • Paeonia suffruticosa is a perennial plant indigenous to China known for its elegant and vibrantly colorful flowers. The flowers are brightly colored, the magnificence has the reputation of 'the king of flowers'. In the cultivated type, it is mainly based on the color of the flowers, which can be divided into hundreds of varieties. The papery flamboyant blooms and interesting foliage of tree peonies gives the impression that the plants are delicate. Tree peonies are long-lived deciduous shrubs provided they are grown in a suitable spot.[1] [2].
  • Common Name: Mu dan
  • NCBI Taxonomy

Flower Development & Different Cultivars

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • 'Feng Dan' & 'Xi Shi' cultivars
KU853028
  • F:CTGGAGTTTTCACCGACAAGG
  • R:CCAATGGGGCAAGACAGTTAG
186 60 SYBR
UBC[1] Ubiquitin conjugating enzyme
  • 'Feng Dan' &'Xi Shi' cultivars
KU853027
  • F:TACCCAAACAGCCCTCCAAC
  • R:AGCAGCTTCAATGTTTGCCG
234 59 SYBR
EF-1α[1] Elongation factor 1 alpha
  • In 'Que Hao' cultivar
KU853032
  • F:TCCTGGGCATCGTGACTTTA
  • R:TTCATCATACCGAGCCTTTG
232 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ji Yang
  • Email: jiyang@fudan.edu.cn
  • Institution: Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, Fudan University, Shanghai, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Li J, Han J, Hu Y, Yang J (2016) Selection of Reference Genes for Quantitative Real-Time PCR during Flower Development in Tree Peony (Paeonia suffruticosa Andr.). Front Plant Sci 7, 516.
  2. Sang T, Crawford DJ, Stuessy TF (1997) Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84, 1120-1136.

Categories