Panicum virgatum

From ICG
Jump to: navigation, search

Description

Panicum virgatum.png
  • Panicum virgatum L. is a perennial warm-season grass native to North America and a productive C4 species. Used initially as a forage crop, switchgrass is currently being pursued as a dedicated cellulosic biofuel feedstock in the Midwestern and Southeastern United Sates[1][2].
  • Common Name: Switchgrass
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
eEF-1a[1] Elongation factor 1a
  • Leaves, stems, rachis and roots
  • Drought, salt stress treatment
  • Cold and heat shock treatments, wounding stress
GR876801
  • F:CGGTTGGTCGTGTGGAGACT
  • R:TGGTGCATCTCAACAGACTTCAC
100 60 SYBR
eIF-4a[1] Eukaryotic initiation factor 4a
  • Leaves, stems, rachis and roots
  • Drought, salt stress treatment
  • Cold and heat shock treatments, wounding stress
GR877213
  • F:TGATGTCATTCAGCAAGCACAA
  • R:GGCATTCAACCAGGCCATAG
95 60 SYBR
CYP5[1] Cyclophilin 5
  • Leaves, stems, rachis and roots
  • Drought, salt stress treatment
  • Cold and heat shock treatments, wounding stress
FE633090
  • F:CACTACAAGGGAAGCACATTCCA
  • R:TTCACCACCCCTTCCATCAC
95 60 SYBR
U2AF[1] Splicing factor U2af
  • Leaves, stems, rachis and roots
  • Drought, salt stress treatment
  • Cold and heat shock treatments, wounding stress
FL907910
  • F:GGGTCAACTGCCCTTTTTACTTC
  • R:AGCACAAGAGTCGGCGATATG
100 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Eduardo Blumwald
  • Email: eblumwald@ucdavis.edu
  • Institution: Department of Plant Pathology, University of California Davis, Davis, California, United States of America

Citation Statistics

Cited by 44 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Gimeno J, Eattock N, Van Deynze A, et al. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR[J]. PloS one, 2014, 9(3): e91474.
  2. Gimeno J, Eattock N, Van Deynze A, Blumwald E. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR. PLoS One. 2014 Mar 12;9(3):e91474. doi: 10.1371/journal.pone.0091474. eCollection 2014. PubMed PMID: 24621568; PubMed Central PMCID: PMC3951385.

Categories