Panonychus citri

From ICG
Jump to: navigation, search

Description

Panonychus citri.png
  • Panonychus citri (McGregor), is an economically important pest with a wide range of host plants and worldwide distribution. It is the most important allergen producing agent affecting citrus fruit farmers with asthma and rhinitis and a common sensitizing allergen in children living near citrus orchards. Although biological control of P. citri has proven successful in some horticulture crops, chemical acaricides have always played the central role in its control in fields. However, it can develop resistance to various acaricides rapidly due to their short life cycle, abundant progeny and arrhenotokous reproduction[1][2].
  • Common Name: Citrus red spider mite
  • NCBI Taxonomy

Different Developmental Stages & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ELF1A[1] Elongation factor-1 alpha
  • Thermo stress, UV irradiation stress, acaricides stress
HM582444
  • F:GGCACTTCGTCTTCCACTTC
  • R:ATGATTCGTGGTGCATCTCA
164 60 SYBR
GAPDH[1] Glyceraldhyde-3-phosphate dehydrogenase
  • Thermo stress, UV irradiation stress, acaricides stress
HM582445
  • F:CTTTGGCCAAGGTCATCAAT
  • R:CGGTAGCGGCAGGTATAATG
159 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jin-Zhi Niu
  • Email: jjwang7008@yahoo.com
  • Institution: Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400716, People’s Republic of China

Citation Statistics

Cited by 40 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Niu J Z, Dou W, Ding T B, et al. Evaluation of suitable reference genes for quantitative RT-PCR during development and abiotic stress in Panonychus citri (McGregor)(Acari: Tetranychidae)[J]. Molecular biology reports, 2012, 39(5): 5841-5849.
  2. Hendriks-Balk M, Michel M, Alewijnse A (2007) Pitfalls in the normalization of real-time polymerase chain reaction data. Basic Res Cardiol 102(3):195–197. doi:10.1007/s00395-007-0649-0.

Categories