Caragana korshinskii

Description

Caragana korshinskii, a leguminous shrub species, is a native desert shrub with strong drought-resistance, sand-fixing capacity and high forage value that is widespread in the desert land of west and northwest China, is commonly found in arid and semi-arid lands in northwestern China. C. korshinskii, Hedysarum scoparium Fisch., and Artemisia ordosica Kracsh. were the main species initially employed for vegetation restoration in desert areas in China^[1].
Common Name: Peashrub
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GAPDH^[1]	Glyceraldehyde 3-phosphate dehydrogenase	Drought, heat, cold, salt ABA and high pH treatment	KC679843	F:GCATTCCGTGTACCTACTCCCA R:CAACATCCTCGTCTGTGTATCCA	151	60	SYBR
EF1a^[1]	Elongation factor 1-alpha-like	Drought, heat, cold, salt ABA and high pH treatment	KC679842	F:CAAAAAGTCCCCTCGTTGTCTC R:AGCAATCGTTCTTCCTAATGATCTAA	142	60	SYBR
SKIP5-1^[1]	F-box protein SKIP5-1-like	Drought, heat, cold, salt ABA and high pH treatment	KC679845	F:GCTTCCTTCCCCCTATTCCAG R:AAAACACCAGGTTCAGATAAGTCTTTG	133	60	SYBR

Name: Guojing Li
Email: liguojing@imau.edu.cn
Institution: College of Life Sciences, Inner Mongolia Agricultural University, Hohhot 010018, People's Republic of China

Cited by 23 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Yang Q, Yin JJ, Li G, et al. (2014) Reference gene selection for qRT-PCR in Caragana korshinskii Kom. under different stress conditions. Molecular Biology Reports 41, 2325-2334.