Pecten maximus

From ICG
Jump to: navigation, search

Description

Pecten maximus.png
  • Pecten maximus is a commercially important species in Europe. P. maximus is a simultaneous hermaphrodite, whose gonad consists of separate male and female parts. P. maximus displays a seasonal reproductive behavior in Galicia characteristic of many marine bivalves[1].
  • Common Name: Great Scallop, King scallop
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ndufa7[1] NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 7
  • Ovary & testis
HE572783
  • F:ATTACACACGAGATGGACGCTG
  • R:ACATCAGAGCTGGCTGTTTCAG
115 60 SYBR
rpsa[1] 40S ribosomal protein SA
  • Ovary
HE572589
  • F:CTGGTCCGCAGCAGCTCCAG
  • R:ATGCCTATCCCCAGTTGTCAG
131 60 SYBR
ef1a[1] Eukaryotic translation elongation factor 1 alpha
  • Ovary
DN794050
  • F:AGGGCTCCTTCAAGTATGCCTG
  • R:TGAGCGGTCTCGAACTTCCAC
100 60 SYBR
gapdh[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Testis
DN794150
  • F:TCCGGATGTGTCTGTTGTTGAC
  • R:TTCAGATCTCCATCAGCTGCAC
102 60 SYBR
18S[1] 18S ribosomal RNA
  • Testis
L49053
  • F:TCGATGGTACGTGATATGCC
  • R:CGTTTCTCATGCTCCCTCTC
84 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Juan Pazos
  • Email: antonioj.pazos@usc.es
  • Institution: Departamento de Bioquímica y Biología Molecular, Instituto de Acuicultura, Universidad de Santiago de Compostela, C/ Constantino Candeira, s/n, 15782 Santiago de Compostela, Spain

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Mauriz O, Maneiro V, Pérez-Parallé M L, et al. Selection of reference genes for quantitative RT-PCR studies on the gonad of the bivalve mollusc Pecten maximus L[J]. Aquaculture, 2012, 370: 158-165.

Categories