Penicillium echinulatum

From ICG
Jump to: navigation, search

Description

Penicillium echinulatum.png
  • Penicillium echinulatum is an important filamentous fungus owing to its effective production of cellulases and hemicellulases. The P. echinulatum variant S1M29 is currently the best cellulolytic mutant of this species. Studies of P. echinulatum reveal the potential of its enzymes for applications in the textile industry, and in the hydrolysis of cellulose for production of second-generation ethanol[1][2].
  • Common Name: Penicillium echinulatum
  • NCBI Taxonomy

Culture Condition

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
actb[1] β-actin
  • Conditions to either induce (cellulose and sugar cane bagasse) or repress (glucose)
NA
  • F:AACTTCTCCTCGAAACCCTCCA
  • R:GTCGTGTACTGTGAGGTGCATACTT
NA NA SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Denise Zampieri
  • Email: denisezampi@hotmail.com
  • Institution: Institute of Biotechnology, University of Caxias do Sul, P.O. Box 1352, Caxias do Sul, RS 95070‐560, Brazil

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Zampieri D, Nora L C, Basso V, et al. Validation of reference genes in Penicillium echinulatum to enable gene expression study using real-time quantitative RT-PCR[J]. Current genetics, 2014, 60(3): 231-236.
  2. Dillon AJP, Zorgi C, Camassola M, Henriques JAP. Use of 2-deoxyglucose in liquid media for the selection of mutant strains of Penicillium echinulatum producing increased cellulase and -glucosidase activities. Appl Microbiol Biotechnol 2006;70:740–6.

Categories