Pericallis cruenta

From ICG
Jump to: navigation, search

Description

Pericallis cruenta.png
  • Pericallis cruenta is rich in flower color, it can be used for both potted and outdoor landscaping. It accumulates delphinin, cyanin and pelargonin to form blue, carmine and pink colors flowers, respectively. Many closely related cultivars display dramatically diverse floral color patterns and can synthesize all three of the anthocyanin branches, providing an outstanding study system to understand the molecular principles underlying phenotypic diversification, plant–pollinator interactions and the mechanism regulating anthocyanin branching[1][2].
  • NCBI Taxonomy

Flower Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • Different color lines of cineraria during their flower developmental stages
KC508622
  • F:CTCCAATCAGTTTGCCCTCACA
  • R:TATCCGTATTGCCACAGCCTTG
206 60 SYBR
Actin[1] Actin related protein 2
  • Different color lines of cineraria during their flower developmental stages
KC508616
  • F:TCTTGAGGAAGGAGTTGGTTGC
  • R:CTCGCCTTCAGATTTCAACTTC
136 60 SYBR
PP2A[1] Protein phosphatase 2A
  • Different color lines of cineraria during their flower developmental stages
KC508620
  • F:ACCGTATTCAGGAGGTCCCACA
  • R:AAATCCCCCACCCGCACCTATC
84 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Silan Dai
  • Email: silandai@sina.com
  • Institution: College of Landscape Architecture, Beijing Forestry University, Beijing 100083, People’s Republic of China

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Jin X, Fu J, Dai S, et al. Reference gene selection for qPCR analysis in cineraria developing flowers[J]. Scientia Horticulturae, 2013, 153: 64-70.
  2. Jin X, Huang H, Wang L, Sun Y, Dai S. Transcriptomics and Metabolite Analysis Reveals the Molecular Mechanism of Anthocyanin Biosynthesis Branch Pathway in Different Senecio cruentus Cultivars. Front Plant Sci. 2016 Sep 5;7:1307. doi: 10.3389/fpls.2016.01307. eCollection 2016. PubMed PMID: 27656188; PubMed Central PMCID: PMC5012328.

Categories