Peucedanum praeruptorum

From ICG
Jump to: navigation, search

Description

Peucedanum praeruptorum.png
  • Peucedanum praeruptorum is a popular Chinese herb that is frequently used in many traditional herbal remedies. Its main medicinal part is the root that produce coumarins. As a vital medicine to help cough up mucus, it is commonly used in the treatment of ailments that are associated with the symptoms of coughing and phlegm. What’s more, it can be also used in dysentery, chronic enteritis, chronic obstructive pulmonary disease with secondary pulmonary hypertension, baby crying at night for no reason, furuncle, and so on.[1] [2].
  • Common Name: Qian Hu
  • NCBI Taxonomy

Abiotic Stresses & Hormone Treatment & Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • NaCl,MeJA,SA,cold stress
NA (from Unpublic Transcriptome Data)
  • F:ACAGAAGAGCCTCATGAATCCC
  • R:CAAGCAAAGGCGTCATATCAAA
98 60 SYBR
ACT2[1] Actin 2
  • H2O2 and hot stress
NA (from Unpublic Transcriptome Data)
  • F:TTTCACTATATGCCAGTGGTCG
  • R:CTTCGTAGATCGGGACAGTGTG
84 60 SYBR
UBC9[1] Ubiquitin-conjugating enzyme 9
  • CuSO4 stress
NA (from Unpublic Transcriptome Data)
  • F:CTCGAAGCGGATCTTGAAGGAG
  • R:CACCCGCATATGGACTGTCAGG
137 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Lingyi Kong
  • Email: cpu_lykong@126.com
  • Institution: State Key Laboratory of Natural Medicines, Department of Natural Medicinal Chemistry, China Pharmaceutical University, Nanjing, Jiangsu, P. R. China,

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Zhao Y, Luo J, Xu S, et al. Selection of reference genes for gene expression normalization in Peucedanum praeruptorum dunn under abiotic stresses, hormone treatments and different tissues[J]. PloS one, 2016, 11(3): e0152356.
  2. Kang A, Xie T, Zhu D, et al. (2017) Comparative pharmacokinetic study of pyranocoumarins and khellactone in normal and acute lung injury rats after oral administration of Peucedanum praeruptorum Dunn extracts using a rapid and sensitive liquid chromatography-tandem mass spectrometry method. Biomedical chromatography : BMC.

Categories