Phaseolus vulgaris

From ICG
Jump to: navigation, search

Description

Phaseolus vulgaris.png
  • Phaseolus vulgaris is the most important legume for direct human consumption, providing an important source of minerals and proteins. Increasing the concentrations of these nutrients is a breeding objective worldwide. Wild common bean is organized in two geographically isolated and genetically differentiated wild gene pools that diverged from a common ancestral wild population more than 100,000 years ago. Common bean was independently domesticated in what is now Mexico and in South America, and the following local adaptations resulting in landraces with distinct characteristics[1][2].
  • Common Name: String bean, Bean, Common Bean
  • NCBI Taxonomy

Biotic & Abiotic Stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
IDE[1] Insulin degrading enzyme
  • Biotic stress analysis
171614244
  • F:GCAACCAACCTTTCATCAGC
  • R:AGAAATGCCTCAACCCTTTG
156 81.1 SYBR
Act11[1] Actin-11
  • Biotic & abiotic stress
62703083
  • F:TGCATACGTTGGTGATGAGG
  • R:AGCCTTGGGGTTAAGAGGAG
190 79.4 SYBR
Skip16[1] SKP1/ASK-interacting protein 16
  • Abiotic stress
187434529
  • F:CACCAGGATGCAAAAGTGG
  • R:ATCCGCTTGTCCCTTGAAC
163 81.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Danielle Gregorio Gomes Caldas
  • Email: dcaldas@cena.usp.br
  • Institution: Center of Nuclear Energy for Agriculture, Laboratory of Cellular and Molecular Biology, University of São Paulo, P. O. Box 96 CEP, Piracicaba, SP 13400-970, Brazil

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Koči J, Šimo L, Park Y. Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)[J]. Journal of medical entomology, 2013, 50(1): 79-84.
  2. Schmutz J, McClean P E, Mamidi S, et al. A reference genome for common bean and genome-wide analysis of dual domestications[J]. Nature genetics, 2014, 46(7): 707-713.

Categories