Phyllostachys edulis

From ICG
Jump to: navigation, search

Description

Phyllostachys edulis.png
  • Phyllostachys edulis is a large woody bamboo with the highest ecological, economic and cultural value of all bamboos in Asia, accounting for up to 70% of the total area of bamboo growth. Moso bamboo has been valued at US$5 billion of annual forest production in China, used as timber, paper and art ware, and the shoots as delicious food[1][2] .
  • Common Name: Moso bamboo
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TIP41[1] TIP41-like family protein
  • Root, stem, mature stem, leaf, flower, and leaf sheath
  • Two developmental stages (before and after flowering)
FP092936
  • F:AAAATCATTGTAGGCCATTGTCG
  • R:ACTAAATTAAGCCAGCGGGAGTG
102 60 SYBR
NTB[1] Nucleotide tract-binding protein
  • Root, stem, mature stem, leaf, flower, and leaf sheath
  • Two developmental stages (before and after flowering)
FP091427
  • F:TCTTGTTTGACACCGAAGAGGAG
  • R:AATAGCTGTCCCTGGAGGAGTTT
133 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Mengzhu Lu
  • Email: lumz@caf.ac.cn
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 92 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Fan C, Ma J, Guo Q, et al. Selection of reference genes for quantitative real-time PCR in bamboo (Phyllostachys edulis)[J]. PloS one, 2013, 8(2): e56573.
  2. Lobovikov M, Paudel S, Piazza M, Ren H, Wu J. World Bamboo Resources: A Thematic Study Prepared in the Framework of the Global Forest Resources Assessment (Food and Agriculture Organization of the United Nations, Rome, 2007); 2005.

Categories