Pinus massoniana

From ICG
Jump to: navigation, search

Description

Pinus massoniana-1.jpg
  • Pinus massoniana belongs to the family Pinaceae Lindl., Pinus Linn. This adaptable and rapidly growing species is a typical ancient coniferous unique native tree in the southern part of China and is widely distributed throughout the 17 provinces (autonomous regions) of China. PM is distributed over a 2 million km2 area and is a particularly important type of local conifer. This tree can be fast-growing with a high yield and is comprehensively utilized; e.g., PM is used in the development of PM man-made forests in the Chinese forest industry [1][2].
  • Common Name: Chinese red pine
  • NCBI Taxonomy

Different Tissues & Floral Organ Development & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Fbox[2] F-box family protein
  • Salt stress
  • Drought stress
KM496542
  • F:GCAGAGGTGGAGAGTGGAAG
  • R:GGTGGTTTATGTTGCCGAAT
111 60 SYBR
UBI11[2] Polyubiquitin 11
  • Salt stress
KM496540
  • F:AATCAACCCTGCATCTCGTC
  • R:CTGGATCTTGGCCTTGACAT
131 60 SYBR
RRP8[2] ribosomal RNA-processing protein 8
  • Drought stress
KM496537
  • F:GCAGGTTATCAGGAGCAGATG
  • R:GATGGTTCACAGGAGACGAGA
179 60 SYBR
ARF[2] ADP-ribosylation factor
  • Low temperature stress
KM496546
  • F:GAACAAACCTTCTTTGCATGG
  • R:GGACTCAAGACCCATCTGGT
109 58~59 SYBR
TUBA[2] Tubulin alpha
  • Low temperature stress
KM496535
  • F:CCAGTTTGTTGATTGGTGTCC
  • R:ACGGCTCTCTGAACCTTGG
102 60 SYBR
EF1B[2] Elongation factor 1-beta
  • Flowers in different developmental phases
KM496533
  • F:GGTGAAGAAACCGAAGAGGAA
  • R:CCACAGCAAACCATCCATC
186 60 SYBR
IDH[2] Isocitrate dehydrogenase
  • Flowers in different developmental phases
KM496545
  • F:CAGTAAGACCCACGCAGTTC
  • R:CGTCATTTCATCACCATCCA
100 58~60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhangqi Yang
  • Email: yangzhangqi@163.com
  • Institute: Guangxi Key Laboratory of Superior Timber Trees Resource Cultivation, Guangxi Forestry Research Institute of Science, Nanning 530002, People’s Republic of China

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

References

  1. Hu Chen, Zhangqi Yang, Ying Hu, Jianhui Tan, Jie Jia, Hulan Xu, Xinhua Chen. Reference genes selection for quantitative gene expression studies in Pinus massoniana L. Trees DOI 10.1007/s00468-015-1311-3
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 Chen, Hu, et al. Reference genes selection for quantitative gene expression studies in Pinus massoniana L. Trees 30.3 (2016): 685-696.

Categories