Platycladus orientalis

From ICG
Jump to: navigation, search

Description

Platycladus orientalis.png
  • Platycladus orientalis is a tree species that is highly resistant, widely adaptable, and long-lived, with lifespans of even thousands of years. As a member of the Cupressaceae, it is used extensively as a medicinal ingredient and as an ornamental landscape plant that can tolerate a wide range of environmental extremes. Many individuals of this species have lifespans of one to several thousands of years in China[1].
  • Common Name: Cupressaceae
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • Different tissues
  • Cold treated
NA
  • F:GGAGGTTCCACCATGTTTCC
  • R:GTGCTGAGCGAAGCGAGAAT
152 60 SYBR
UBQ [1] Ubiquitin 10
  • NaCl-treated
  • ABA-treated
NA
  • F:AGGGGAGGCATGCAGATTTT
  • R:AGGAATGCCCTCCTTGTCCT
120 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zeping Jiang
  • Email: jiangzp@caf.ac.cn
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 98 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Chang E, Shi S, Liu J, et al. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (Cupressaceae) using real-time PCR[J]. PloS one, 2012, 7(3): e33278.

Categories