Pleurotus ostreatus

From ICG
Jump to: navigation, search

Description

Pleurotus ostreatus-1.jpg
  • Pleurotus ostreatus is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value [1].
  • Common Name: Oyster mushroom
  • NCBI Taxonomy

Various Culture Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
sar1[1] Secretion-associated Ras-related 1
  • SmF cultures
NA
  • F:GGATAGTCTTCCTCGTCGATAG
  • R:GGGTGCGTCAATCTTGTTAC
133 63 SYBR
pep[1]  strain EPGS 
  • SmF cultures
NA
  • F:TGATTCCAGAGGACAAGGACGCAA
  • R:AAATCTTCCGCGATACGGGTCACT
148 63 SYBR
phos[1] phosphate-binding protein PhoS
  • SmF cultures
NA
  • F:CATCGCAAATCATCGATCGCACCA
  • R:GCTCTCCAGCCAATGCACCAATTT
125 63 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Lucía Ramírez
  • Email: lramirez@unavarra.es
  • Institution: Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Castanera R, López-Varas L, Pisabarro AG, Ramírez L. Validation of Reference Genes for Transcriptional Analyses in Pleurotus ostreatus by Using Reverse Transcription-Quantitative PCR. Appl Environ Microbiol. 2015 Jun 15;81(12):4120-9. doi: 10.1128/AEM.00402-15. Epub 2015 Apr 10. PubMed PMID: 25862220; PubMed Central PMCID: PMC4524153.

Categories