Plukenetia volubilis

From ICG
Jump to: navigation, search

Description

Plukenetia volubilis.png
  • Plukenetia volubilis is a perennial plant with somewhat hairy leaves in the Euphorbiaceae. It is native to the rain forest of South America. The plant reaches a height of 2m, with alternate, heart shaped, serrated leaves. It flowers five months after being planted, and bears seeds around the eighth month. Its seed oil is rich in polyunsaturated fatty acids (PUFAs) and lipovitamins, which has great potential economic value to the food and pharmaceutical industries. Moreover, its oil is also a good feedstock for biodiesel production[1][2].
  • Common Name: Sacha inchi, Sacha peanut, Mountain peanut
  • NCBI Taxonomy

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UCE[1] Ubiquitin-conjugating enzyme
  • Flower and seed development
  • Roots, stems, leaves, flowers, and seeds from adult plants
  • Development of reproductive organs
NA
  • F:TGGAATGGATGACGGAGACGACAT
  • R:AACACTTGGTGGCTTCTCTGGATAATC
142 78.74 SYBR
ACT[1] Actin
  • Flower and seed development
  • Roots, stems, leaves, flowers, and seeds from adult plants
  • Development of reproductive organs
NA
  • F:CCAGAAGTCTTGTTCCAGCCATCTC
  • R:GCGGTGATCTCCTTGCTCATACG
140 80.66 SYBR
EF1α[1] Elongation factor 1-alpha
  • Flower and seed development
  • Roots, stems, leaves, flowers, and seeds from adult plants
  • Development of reproductive organs
NA
  • F:GGTATTCTCAAGCCTGGTATGGTTGT
  • R:GAGAGCCTCCTGAAGAGCCTCAT
102 80.48 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zeng-Fu Xu
  • Email: zfxu@xtbg.ac.cn
  • Institution: School of Life Sciences, University of Science and Technology of China, Hefei 230027, China

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Niu L, Tao YB, Chen MS, et al. (2015) Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR. Int J Mol Sci 16, 12513-12530.
  2. Gillespie LJ (2007) A revision of paleotropical Plukenetia (Euphorbiaceae) including two new species from Madagascar. Systematic Botany 32, 780-802.

Categories