Plutella xylostella

From ICG
Jump to: navigation, search

Description

Plutella xylostella.png
  • Plutella xylostella (L.) is a highly destructive pest of cruciferous crops worldwide. It has developed resistance to a wide array of insecticides. Its genome is the very first genome documenting an insect pest of agricultural importance. Moreover, it has become an emerging insect model to study insect-plant interactions[1][2][3].
  • Common Name: Diamondback moth
  • NCBI Taxonomy

Different Developmental Stages & Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS13[1] Ribosomal protein S13
  • Development stage, Photoperiod, Insecticide susceptibility
AY174891
  • F:TCAGGCTTATTCTCGTCG
  • R:GCTGTGCTGGATTCGTAC
100 60 SYBR
RPS23[1] Ribosomal protein S23
  • Development stage, Tissue, Insecticide susceptibility
AY174891
  • F:ATGGGCTGACAAGGATTAC
  • R:TGCGGATGGCAGAGTT
140 60 SYBR
EF1[1] Elongation factor 1
  • Development stage, Tissue, Strain, Insecticide susceptibility,Photoperiod,Mechanical injury
EF417849
  • F:GCCTCCCTACAGCGAATC
  • R:CCTTGAACCAGGGCATCT
161 60 SYBR
RPL32[1] Ribosomal protein L32
  • Tissue,Temperature, Strain, Insecticide susceptibility,Photoperiod,Mechanical injury
AB180441
  • F:CCAATTTACCGCCCTACC
  • R:TACCCTGTTGTCAATACCTCT
120 60 SYBR
ACTB[1] β-actin
  • Strain & Temperature
AB282645
  • F:GCGACTTGACCGACTACCT
  • R:GCCGCAAGATTCCATACCC
272 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehy- drogenase
  • Strain
AJ489521
  • F:GCCACCACTGCCACTC
  • R:CGGGACGGGAACACG
177 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Youjun Zhang
  • Email: zhangyoujun@caas.cn
  • Institution: Institute of Pesticide Science, Hunan Agricultural University, Changsha 410128, China

Citation Statistics

Cited by 55 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Fu W, Xie W, Zhang Z, et al. Exploring valid reference genes for quantitative real-time PCR analysis in Plutella xylostella (Lepidoptera: Plutellidae)[J]. International journal of biological sciences, 2013, 9(8): 792.
  2. Talekar N, Shelton A. Biology, ecology, and management of the diamondback moth. Annu Rev Entomol. 1993; 38: 275-301.
  3. You M, Yue Z, He W, et al. A heterozygous moth genome provides insights into herbivory and detoxification. Nat Genetics. 2013; 45: 220–225.

Categories