Poa pratensis

From ICG
Jump to: navigation, search

Description

Poa pratensis-1.jpg
  • Kentucky bluegrass (Poa pratensis L.) belongs to the Gramineae family and is widely used in lawns, golf courses, landscapes, and sports fields as a prominent cool-season grass [1].This grass is often subjected to various abiotic stresses, which result in reduced aesthetic quality and seed yield [2].
  • Common Name: Kentucky bluegrass
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SAM[1] S-Adenosylmethionine decarboxylase
  • Leaves under salt stress and cold stress
  • Drought-treated leaves
  • Heat-treated leaves
NA
  • F:GCTTCTCTGAGGAGGTTGATGTC
  • R:GCTCGGTGGCATAGTAGATGTG
126 55 SYBR
GAPDH[1] Glyceraldehyde 3-phosphate Dehydrogenase
  • Leaves under salt stress and cold stress
  • Roots under salt or cold stress
  • Drought-treated roots
NA
  • F:AAGGACTGGAGAGGTGGAAGG
  • R:AGTGCTGCTTGGAATGATGTTG
54 55 SYBR
TUB[1] Alpha tubulin-2B
  • Roots under salt or cold stress
  • Heat-treated leaves
NA
  • F:ACTGATGTGGCGGTCCTTCTC
  • R:CTGTTGAGGTTGGTGTAGGTTGG
95 55 SYBR
ACT[1] Actin7
  • Roots under salt or cold stress
  • Drought-treated leaves
  • Drought-treated roots
  • Heat-treatedroots
NA
  • F:TGTTGGATTCTGGTGATGGTGTC
  • R:AGGATGGCGTGCGGAAGG
73 55 SYBR
RPL[1] Ribosomal protein L2
  • Heat-treatedroots
NA
  • F:GATTGTTCAGGTCGCTGGTG
  • R:CAACAGGTTTCATGGGCACA
127 55 SYBR
PpFEH[1] Fructan exohydrolase
  • Drought and cold stress
NA
  • F:AGGTTGGGCGGGTATCTATG
  • R:CAGCCTGCACAGTGTCAATT
182 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Huiling Ma
  • Email: mahl@gsau.edu.cn
  • Institution: Key Laboratory of Grassland Ecosystem of Ministry of Education, College of Grassland Science, Gansu Agricultural University, Lanzhou, China

Citation Statistics

Cited by 2 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Niu K, Shi Y, Ma H. Selection of Candidate Reference Genes for Gene Expression Analysis in Kentucky Bluegrass (Poa pratensis L.) under Abiotic Stress. Front Plant Sci. 2017 Feb 14;8:193. doi: 10.3389/fpls.2017.00193. eCollection 2017. PubMed PMID: 28261247; PubMed Central PMCID: PMC5306334.
  2. Puyang X, An M, Han L, Zhang X. Protective effect of spermidine on salt stress induced oxidative damage in two Kentucky bluegrass (Poa pratensis L.) cultivars. Ecotoxicol Environ Saf. 2015 Jul;117:96-106. doi: 10.1016/j.ecoenv.2015.03.023. Epub 2015 Apr 1. PubMed PMID: 25841065.

Categories