Posidonia oceanica

From ICG
Jump to: navigation, search

Description

Posidonia oceanica.png
  • Posidonia oceanica is an endemic Mediterranean seagrass, widely distributed along the Mediterranean coasts where it forms large monospecific beds across a wide bathymetric gradient. It has a monoecious mating system and is capable of long-range dispersal by floating fruits. Althouth extremely sensitive to both moderate and high levels of disturbances, P. oceanica meadows can provide key ecological services in the coastal area, including maintenance of marine biodiversity, organic carbon production and export, sediment stabilization and coastal erosion prevention[1][2].
  • Common Name: Neptune grass
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S[1] Ribosomal RNA 18S
  • Salinity Treatment
  • PH Treatment
  • Light Treatment
AY491942.1
  • F:AACGAGACCTCAGCCTGCTA
  • R:AAGATTACCCAAGCCTGTCG
200 60 SYBR
EF1A[1] Elongation factor 1-alpha
  • Salinity Treatment
  • PH Treatment
  • Light Treatment
GO346663
  • F:GAGAAGGAAGCTGCTGAAATG
  • R:GAACAGCACAATCAGCCTGAG
214 60 SYBR
NTUBC[1] Ubiquitin-conjugating enzyme
  • Salinity Treatment
  • PH Treatment
  • Light Treatment
GO347619
  • F:TCTGCTCGATTCCGAGTTTT
  • R:GCTTGAAGTCCCTCATCAGC
128 60 SYBR
UBI[1] Ubiquitin
  • Salinity Treatment
  • PH Treatment
  • Light Treatment
GO347694
  • F:CACCCTCGCTGACTACAACA
  • R:TTTCTCAGCCTGACGACCTT
195 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ilia Anna Serra
  • Email: gpro@szn.it
  • Institution: Stazione Zoologica Anton Dohrn,Villa Comunale, 80121 Naples, Italy

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Serra I A, Lauritano C, Dattolo E, et al. Reference genes assessment for the seagrass Posidonia oceanica in different salinity, pH and light conditions[J]. Marine biology, 2012, 159(6): 1269-1282.
  2. Andersen CL, Jensen JL, Orntoft TF (2004) Normalization of realtime quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64:5245–5250.

Categories