Brachypodium distachyon

Description

Brachypodium distachyon is a model plant because of its phylogenetic position which is more closely related to wheat and barley than to rice or maize. It is proved to be a valuable system for the study of specific processes, including dissecting the biology of the cell wall, the development of the endosperm, the controls of flowering, and the development of inflorescence. In addition, it has the usual characteristics of a model system (rapid cycling, small stature,small genome size, ease of growth)^[1]^[2].
Common Name: Purple false brome
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
UBC18^[1]	Ubiquitin-conjugating enzyme 18	Different tissues & development stages under various growth conditions	DV481689	F:GGAGGCACCTCAGGTCATTT R:ATAGCGGTCATTGTCTTGCG	193 bp	60	SYBR
Ubi4^[1]	Polyubiquitin	Different tissues and growth hormone-treated samples	DV482834	F:TGACACCATCGACAACGTGA R:GAGGGTGGACTCCTTCTGGA	126 bp	60	SYBR
Ubi10^[1]	Polyubiquitin	Different tissues and growth hormone-treated samples	DV484269	F:TCCACACTCCACTTGGTGCT R:GAGGGTGGACTCCTTTTGGA	237 bp	60	SYBR
SamDC^[1]	S-adenosylmethionine decarboxylase	Different samples grown under various environmental stresses	DV482676	F:TGCTAATCTGCTCCAATGGC R:GACGCAGCTGACCACCTAGA	190 bp	60	SYBR

Name: Chung-Mo Park
Email: cmpark@snu.ac.kr
Institution: Department of Chemistry, Seoul National University, Seoul, 151-742, Korea

Cited by 88 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 Cappelli K, Felicetti M, Capomaccio S, Spinsanti G, Silvestrelli M, Supplizi AV. Exercise induced stress in horses: selection of the most stable reference genes for quantitative RT-PCR normalization. BMC Mol Biol. 2008 May 19;9:49. doi: 10.1186/1471-2199-9-49. PubMed PMID: 18489742; PubMed Central PMCID: PMC2412902.
↑ Hong SY, Seo PJ, Yang MS, Xiang F, Park CM. Exploring valid reference genes for gene expression studies in Brachypodium distachyon by real-time PCR. BMC Plant Biol. 2008 Nov 7;8:112. doi: 10.1186/1471-2229-8-112. PubMed PMID: 18992143; PubMed Central PMCID: PMC2588586.