Pyropia yezoensis

From ICG
Jump to: navigation, search

Description

Pyropia yezoensis.png
  • Pyropia yezoensis, growing in the intertidal zone, is an economically important seaweed and is widely cultivated in China, Japan, and Korea. It is periodically exposed to air where it experiences a variety of potentially stressful environmental conditions, including nutrient limitation, high light, high and low temperature, desiccation, and osmotic stress[1] [2].
  • Common Name: Red alga
  • NCBI Taxonomy

Different Developmental Stages & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT3[2] Actin3
  • Stress conditions
AB126237
  • F:CAAGCAGAAGGGCATCAT
  • R:CCGAGTAGAAAGCGTGGT
164 60 SYBR
eIF4A[2] Translation initiation factor 4A
  • Different Stress conditions & developmental stages
FJ407185
  • F:GCTTTCTGTCTGGACGAGG
  • R:TCTTCACAAGGATGCGGAT
181 60 SYBR
EF1α[2] Elongation factor 1-α
  • Different Stress conditions & developmental stages
FJ407185
  • F:TTTTGGTGGCACTGCTGAT
  • R:TACACGCACAAGTTGGGGA
141 60 SYBR
UBQ[2] Ubiquitin
  • Different developmental stages
FJ232910
  • F:TTTCCAAGGTGCTCCTCTCCATC
  • R:CGTCTCTTCATAGCGACTGCGGTT
116 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yunxiang Mao
  • Email: yxmao@ouc.edu.cn
  • Institution: College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. Davison IR, Pearson GA (1996) Stress tolerance in intertidal seaweeds. Journal of Phycology 32, 197-211.
  2. 2.0 2.1 2.2 2.3 2.4 Kong F, Cao M, Sun P, Liu W, Mao Y (2014) Selection of reference genes for gene expression normalization in Pyropia yezoensis using quantitative real-time PCR. Journal of Applied Phycology 27, 1003-1010.

Categories