Pyrus pyrifolia

From ICG
Jump to: navigation, search

Description

Pyrus pyrifolia.png
  • Pear (Pyrus pyrifolia), belonging to the subfamily Maloideae in Rosaceae, Which constitute an economically-significant group of fleshy fruit species important for human diet, dietary diversity and ornamental beauty. The Pyroideae subfamily (to which pear and apple belong) are characterized by the pome fruits which is made up of complex fruiting organs with different expanded tissues derived from the floral tube. It have been cultivated in Europe, East Asia, and North America for up to 3000 years and is commercially grown in about 50 temperate-climate countries[1][2].
  • Common Name: Nashi pear
  • NCBI Taxonomy

Different Tissue & Seasonal Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HIS[1] Histone H3
  • Flower bud, flower organ, fruit flesh and fruit skin
AB824718
  • F:GTCAAGAAGCCCCACAGATAC
  • R:CTGGAAACGCAGATCAGTCTTG
153 60 SYBR
SAND[1] SAND protein
  • Flower bud, flower organ, fruit flesh and fruit skin
AB824718
  • F:CCCAGGACTTTGAGCTTTATGC
  • R:TATCACCATGAAAAGGGGCTTG
145 60 SYBR
TIP[1] TIP41 protein
  • Flower bud, flower organ, fruit flesh and fruit skin
AB795983
  • F:ATCCAAGCATCATCAGCCAAAG
  • R:GGAACAATAACTCTTGCAGGGAGA
113 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Tsuyoshi Imai
  • Email: imagic@affrc.go.jp
  • Institution: Plant Physiology and Fruit Chemistry Division, NARO Institute of Fruit Tree Science, Tsukuba, Ibaraki, Japan

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Imai T, Ubi BE, Saito T, Moriguchi T (2014) Evaluation of reference genes for accurate normalization of gene expression for real time-quantitative PCR in Pyrus pyrifolia using different tissue samples and seasonal conditions. PLoS One 9, e86492.
  2. Wang L, Li XG, Wang L, et al. (2017) Construction of a high-density genetic linkage map in pear (Pyrus communis x Pyrus pyrifolia nakai) using SSRs and SNPs developed by SLAF-seq. Scientia Horticulturae 218, 198-204.

Categories