Rhododendron simsii

From ICG
Jump to: navigation, search

Description

Rhododendron simsii.png

Rhododendron simsii is a small shrub (2–5 m) that occurs naturally in forests and forest margins at altitudes between 500–2700 m a.s.l. (eFloras) and is distributed from subtropical China to Japan, Laos, Myanmar and Thailand. It is described as shade-intolerant and self-sterile, with bee-pollinated flowers and small seeds. It is an important ornamentals with a long breeding tradition, it is a rare species in this genus flowering during summer, which provides a unique resource for floral timing breeding[1][2].

Flower Colour

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HK5[1] Histone H3
  • Flower buds in the candle stage
AM932886
  • F:GAAACTCCCATTCCAGAGGCT
  • R:GCATGGATGGCACAGAGGTT
153 60 SYBR
HK173[1] Pyruvate dehydrogenase
  • Flower buds in the candle stage
FN552704
  • F:GGTGCGAGATTGGTATTTGGA
  • R:TTGAACTCCCAAAGCCATTGT
151 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ellen De Keyser
  • Email: Ellen.dekeyser@ilvo.vlaanderen.be
  • Institution: Institute for Agricultural and Fisheries Research (ILVO)-Plant Sciences Unit, Caritasstraat 21, 9090, Melle, Belgium

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 De Keyser E, Desmet L, Van Bockstaele E, et al. How to perform RT-qPCR accurately in plant species? A case study on flower colour gene expression in an azalea (Rhododendron simsii hybrids) mapping population[J]. BMC molecular biology, 2013, 14(1): 13.
  2. Zhengqi Fan, Jiyuan Li, Xinlei Li, Bin Wu, Jiangying Wang, Zhongchi Liu & Hengfu Yin. Genome-wide transcriptome profiling provides insights into floral bud development of summer-flowering Camellia azalea. Sci Rep. 2015 May 15;5:9729. doi: 10.1038/srep09729.PMID: 25978548.

Categories