Saccharomyces cerevisiae

From ICG
Jump to: navigation, search

Description

Saccharomyces cerevisiae.png
  • Saccharomyces cerevisiae is a species of yeast, which has been instrumental to winemaking, baking, and brewing since ancient times. It is believed to have been originally isolated from the skin of grapes. Saccharomyces cerevisiae is one of the most intensively studied eukaryotic model organisms in molecular and cell biology, much like Escherichia coli as the model bacterium. It is the microorganism behind the most common type of fermentation. It reproduces by a division process known as budding[1][2].
  • Common Name: Yeast
  • NCBI Taxonomy

Various Physiological States

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ALG9[1] Alpha-1,2-mannosyltransferase
  • Universal reference genes
NA
  • F:CACGGATAGTGGCTTTGGTGAACAATTAC
  • R:TATGATTATCTGGCAGCAGGAAAGAACTTGGG
93 56 SYBR
TAF10[1] TATA-box binding protein associated factor 10 
  • Universal reference genes
NA
  • F:ATATTCCAGGATCAGGTCTTCCGTAGC
  • R:GTAGTCTTCTCATTCTGTTGATGTTGTTGTTG
96 56 SYBR
TFC1[1] Transcription factor TFIIIC subunit
  • Universal reference genes
NA
  • F:GCTGGCACTCATATCTTATCGTTTCACAATGG
  • R:GAACCTGCTGTCAATACCGCCTGGAG
91 56 SYBR
UBC6[1] E2 ubiquitin-conjugating protein
  • Universal reference genes
NA
  • F:GATACTTGGAATCCTGGCTGGTCTGTCTC
  • R:AAAGGGTCTTCTGTTTCATCACCTGTATTTGC
84 56 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jean-Luc Parrou
  • Email: Jean-Luc.Parrou@insa-toulouse.fr
  • Institution: CNRS, UMR5504, F-31400 Toulouse, France

Citation Statistics

Cited by 222 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Teste M A, Duquenne M, François J M, et al. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae[J]. BMC molecular biology, 2009, 10(1): 99.
  2. Alonso-del-Real J, Lairón-Peris M, Barrio E, Querol A. Effect of Temperature on the Prevalence of Saccharomyces Non cerevisiae Species against a S. cerevisiae Wine Strain in Wine Fermentation: Competition, Physiological Fitness, and Influence in Final Wine Composition. Frontiers in Microbiology. 2017;8:150. doi:10.3389/fmicb.2017.00150.

Categories