Saccharum hybrid cultivar

From ICG
Jump to: navigation, search

Description

Saccharum hybrid cultivar.png
  • Saccharum hybrid cultivar or Saccharum spp. is a major crop with vegetative propagation and capacity to accumulate high levels of sucrose in the culms. The use of sugarcane as a source of sugar and ethanol has been very important to the Brazilian economy. Despite the economic importance of sugarcane, the knowledge of relevant genetic mechanisms remains challenging, due to the fact that this crop presents one of the largest and most intricate genomes of the plant kingdom, with diploid numbers ranging from 100 to 130 chromosomes, indicating a high ploidy level, as well as regular aneuploidy events[1][2].
  • Common Name: Sugarcane
  • NCBI Taxonomy

Drought Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
H1[1] Histone H1
  • Root tissues
  • Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)
CA116806
  • F:CGCACACGCACACTGAAAG
  • R:CGGTGGCCATGATCAAAAA
NA 60 SYBR
αTUB[1] Alpha-tubulin
  • Root tissues
  • Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)
CN607271
  • F:CCATTGGCAAGGAGATTGTT
  • R:TCCACCAACTGCATTGAAGA
NA 60 SYBR
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Root tissues
  • Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)
CA254672
  • F:GGTTCACTTGAAGGGTGGTG
  • R:TGAGGTGTACCTGTCCTCGTT
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ederson Akio Kido
  • Email: ederson.kido@gmail.com
  • Institution: Federal University of Pernambuco (UFPE/CCB/Genética), 50670-420 Recife, PE, Brazil

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Silva RL, Silva MD, Ferreira Neto JR, et al. (2014) Validation of novel reference genes for reverse transcription quantitative real-time PCR in drought-stressed sugarcane. ScientificWorldJournal 2014, 357052.
  2. Maranho GB, Maranho RC, Desordi R, et al. (2016) Genetic divergence and admixture of ancestral genome groups in the sugarcane variety 'RB867515' (Saccharum spp). Genetics and molecular research : GMR 15

Categories