Salicornia europaea

From ICG
Jump to: navigation, search

Description

Salicornia europaea.png
  • Salicornia europaea is a widely distributed salt-tolerant plant species that produces numerous dimorphic seeds. This annual halophyte almost ubiquitously occupies inland salt marshes of the globe. It has long attracted interest due to its high salt tolerance, reclamation potential, and high pharmaceutical and culinary value. S. europaea reproduces sexually and produces a large number of dimorphic seeds that differ in size and plant position[1][2].
  • Common Name: Common glasswort, Glasswort
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
CAC[1] Clathrin adaptor complexes
  • Universial reference gene
Unigene31433_All
  • F:CGTGCCTTCTGATGCGACTA
  • R:TGCCTCTTCACTTGTGATGCT
166 60 SYBR
UBC[1] Ubiquitin-conjugating enzyme
  • Universial reference gene
Unigene40024_All
  • F:GGGCCAGTCGGTGAAGACAT
  • R:ATGCAACCTTTGGGGGCTTGA
136 60 SYBR
ACT[1] Actin
  • Nitrogen treatment,drought stress & various developmental stages
Unigene31801_All
  • F:TGTTGGTCGGCCTAGACACACT
  • R:AATGGGGCCTCGGTAAGCAAC
228 60 SYBR
α-Tub[1] α-tubulin
  • Nitrogen treatment,drought stress & cold stress
Unigene41384_All
  • F:CCACCAGTGCCTTTGAGCCA
  • R:GCCACAGCAGCGTTCACATC
124 60 SYBR
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Drought stress
Unigene17282_All
  • F:TGGCAAAGGTTAAGATCGGAATCA
  • R:ACGAAGTCAGCTCCTGTGGC
289 60 SYBR
TIP41[1] TIP41-like protein
  • Drought stress
Unigene4197_All
  • F:AGGAAAGCTGCTGGAGAGAGTG
  • R:GGAGCCTCTGGCTAATAGTGCT
105 60 SYBR
DNAJ[1] DnaJ-like protein
  • Heat stress
Unigene19716_All
  • F:TGCCATCAGATCAGTGCAAGT
  • R:TCTTCGTAAGCCTCTTGCTGG
169 60 SYBR
UBQ[1] Polyubiquitin
  • Heat stress
Unigene67832_All
  • F:ACGCTGGAGGTCGAAACATC
  • R:TATAATCCGCCAGTGTCCTGC
139 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yinan Ya
  • Email: yaoya@ms.xjb.ac.cn
  • Institution: Key Laboratory of Biogeography and Bioresource in Arid Land, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi, China

Citation Statistics

Cited by 26 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Xiao X, Ma J, Wang J, et al. (2014) Validation of suitable reference genes for gene expression analysis in the halophyte Salicornia europaea by real-time quantitative PCR. Front Plant Sci 5, 788.
  2. (2016) Effect of salinity on seed germination, growth and ion content in dimorphic seeds of Salicornia europaea L. (Chenopodiaceae). Plant Diversity 38, 183-189.

Categories