Salmo salar

From ICG
Jump to: navigation, search

Description

Salmo salar.png
  • Salmo salar is a menber of salmon fish family. This kind of fish is found in the river that flow into the north Atlantic. It is also found in the North Pacific due to human introduction. Atlantic salmon has been significantly reducing because of the recreational and commercial fishing, as well as the habitat destruction. This species is the subject of several national protection efforts.
  • Common Name: Atlantic salmon
  • NCBI Taxonomy

Different Tissues & Smoltification Process

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1AA[1] Elongation factor 1A A
  • Gills, liver, head kidney, spleen, thymus, brain, muscle, and posterior intestine
AF321836
  • F:CCCCTCCAGGACGTTTACAAA
  • R:CACACGGCCCACAGGTACA
57 60 TaqMan
EF1AB[1] Elongation factor 1A B
  • Gills, liver, head kidney, spleen, thymus, brain, muscle, and posterior intestine
BG933853
  • F:TGCCCCTCCAGGATGTCTAC
  • R:CACGGCCCACAGGTACTG
59 60 TaqMan

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institution: National Institute of Nutrition and Seafood Research, Nordnesboder,N-5020 Bergen, Norway

Citation Statistics

Cited by 436 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Olsvik P A, Lie K K, Jordal A E O, et al. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon[J]. BMC Molecular Biology, 2005, 6(1): 21.

Categories