Salvia miltiorrhiza

From ICG
Jump to: navigation, search

Description

Salvia miltiorrhiza.png
  • Salvia miltiorrhiza, known as red sage, Chinese sage, tan shen, or danshen, is a perennial plant in the genus Salvia. It is highly valued for its roots in traditional Chinese medicine. Native to China and Japan, it grows at 90 to 1200 m elevation, preferring grassy places in forests, hillsides, and along stream banks. For several decades, Salvia miltiorrhiza root has been widely used in clinics in China, Korea, Japan and other Asian countries for the treatment of various microcirculatory disturbance-related diseases[1][2] .
  • Common Name: Red sage, Chinese sage, Tan shen, Danshen
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Actin[1] Cytoskeletal structural protein
  • Roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:AGGAACCACCGATCCAGACA
  • R:GGTGCCCTGAGGTCCTGTT
278 58 SYBR
Ubiquitin[1] Ubiquitin protein
  • Roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:GTTGATTTTTGCTGGGAAGC
  • R:GATCTTGGCCTTCACGTTGT
146 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Luqi Huang
  • Email: huangluqi@263.net
  • Institution: Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China

Citation Statistics

Cited by 69 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Yang Y, Hou S, Cui G, et al. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza[J]. Molecular biology reports, 2010, 37(1): 507-513.
  2. Han J Y, Fan J Y, Horie Y, et al. Ameliorating effects of compounds derived from Salvia miltiorrhiza root extract on microcirculatory disturbance and target organ injury by ischemia and reperfusion[J]. Pharmacology & therapeutics, 2008, 117(2): 280-295.

Categories