Leptinotarsa decemlineata

Description

Leptinotarsa decemlineata (Colorado potato beetle) is an exotic invasive insect pest. It invaded in Xinjiang Uygur autonomous region in China in the 1990s from Kazakhstan. It is a notorious defoliator of potato throughout most of the northern Xinjiang, and often causes extremely large yield losses of potato. It has a complicated and diverse life cycle and has developed resistance to many classes of insecticides.
Common Name: Say, Colorado potato beetle
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
RP18^[1]	Ribosomal protein 18	Different developing stages Midgut, fat body and cuticle Insecticide treatments	KC190034	F:ACTTCGTGTCACTGAAACTGC R:TATCCGCACGACTTCCTGC	252	60	SYBR
RP4^[1]	Ribosomal protein 4	Different developing stages Midgut, fat body and cuticle Insecticide treatments	KC190033	F:GCACCAGGTCTTGTTCGTG R:GGGGAATACGGGCGACAG	311	60	SYBR
ARF1^[1]	ADP-ribosylation factor 1	Different developing stages Midgut, fat body and cuticle Insecticide treatments	KC190026	F:GGGGAGGCAAACCGGTCA R:GGCTTCTAAACCTAGTGCCTGG	603	60	SYBR
ARF4^[1]	ADP-ribosylation factor 4	Different developing stages Midgut, fat body and cuticle Insecticide treatments	KC190027	F:GGACCTATCTTCAGCTATGCGT R:CAATCCCTCGTGAAGGCCA	681	60	SYBR

Name: Guo-Qing Li
Email: : liguoqing001234@yahoo.com.cn
Institution: Education Ministry Key Laboratory of Integrated Management of Crop Diseases and Pests, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China

Cited by 60 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Xiao-Qin Shi, Wen-Chao Guo, Pin-Jun Wan, Li-Tao Zhou, Xiang-Liang Ren, Tursun Ahmat, Kai-Yun Fu, and Guo-Qing Li. Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say). BMC Res Notes. 2013; 6: 93. BMC Res Notes. 2013; 6: 93. Published online 2013 Mar 13. doi: 10.1186/1756-0500-6-93. PMCID: PMC3600673.