Sedum alfredii

From ICG
Jump to: navigation, search

Description

Sedum alfredii.png
  • Sedum alfredii is a plant found in an ancient Chinese mining region near Quzhou (Zhejiang Province) and has a strong ability to extract heavy metals from soil. S. alfredii was found to show heavy metal resistance and accumulation, as well as the ability to efficiently transport heavy metals from the root to the shoot. Its roots mainly produce malic acid, oxalic acid, and tartaric acid, presumably contributing to enhanced bioavailability of heavy metals [1][2].
  • Common Name: Alfredii
  • NCBI Taxonomy

Different Heavy Metals Stresses

Heavy Metals Treatments

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBC9[1] Ubiquitin conjugating enzyme 9
  • Cd, Pb, Zn, Cu treatments
KF652106
  • F:TGAGAAGGCAGCCACCTATG
  • R:TGCTGTCACCCTGGAAGTCA
198 60 SYBR
TUB[1] Beta-tubulin
  • Cd, Pb, Zn, Cu treatments
KF652104
  • F:TTATGGCGATTCCGAGCTTCA
  • R:ATTATTTCCAGCGCCGGATTG
193 60 SYBR
ACT2[1] Actin-2
  • Cd and Cu treatments
KF652103
  • F:TTCCGGTGATGGTGTCAGTCA
  • R:ACAATTTCCCGCTCAGCAGTG
165 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Renying Zhuo
  • Email: zhuory@gmail.com
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Beijing, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Sang J, Han X, Liu M, et al. Selection and validation of reference genes for real-time quantitative PCR in hyperaccumulating ecotype of Sedum alfredii under different heavy metals stresses[J]. PloS one, 2013, 8(12): e82927.
  2. Li T, Tao Q, Liang C, Shohag MJ, Yang X, Sparks DL. Complexation with dissolved organic matter and mobility control of heavy metals in the rhizosphere of hyperaccumulator Sedum alfredii. Environ Pollut. 2013 Nov;182:248-55. doi: 10.1016/j.envpol.2013.07.025. Epub 2013 Aug 10. PubMed PMID: 23938448.

Categories