Sesamia inferens

From ICG
Jump to: navigation, search

Description

Sesamia inferens-1.jpg
  • The pink stem borer, Sesamia inferens (Walker) (Lepidoptera: Noctuidae), is a major pest of rice in China and other Asian countries. Recently, damage incited by S. inferens has become more serious. In addition, based on researchers' investigation, the pest now occurs in more northern regions of China (unpublished data) [1].
  • Common Name: purple stem borer
  • NCBI Taxonomy

Different Tissues & Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS13[1] Ribosomal protein S13
  • Head,epidermis, fat body, foregut, midgut, hindgut, Malpighiantubules, haemocytes, and salivary glands
NA
  • F:TGGTAAGGGTATCTCCCAATCA
  • R:TCGTCAGCAGTCAGTTTCAGC
75 60.1 SYBR
RPS20[1] Ribosomal protein S20
  • Head,epidermis, fat body, foregut, midgut, hindgut, Malpighiantubules, haemocytes
  • Different temperatures and salivary glands
NA
  • F:CTCATCAATGGAGCCAAGAAAC
  • R:GTGCAGGTCAATGACACGCT
162 60.1 SYBR
EF1[1] Elongation factor 1
  • Head,epidermis, fat body, foregut, midgut, hindgut, Malpighiantubules, haemocytes
  • Developmental stages and sex and salivary glands
NA
  • F:GTCGCTTTCGTACCCATTTCT
  • R:ACAGTCCATCCCTTGAACCAG
86 56.6 SYBR
18S[1] 18S ribosomal RNA
  • Developmental stages and sex
  • Different temperatures
NA
  • F:CAACACGGGAAATCTCACCA
  • R:GACAAATCGCTCCACCAACTAA
115 55.6 SYBR
GAPDH[1] glyceraldehyde-3 phosphate dehydrogenase
  • Developmental stages and sex
NA
  • F:GGTCATCTCCAACGCTTCCT
  • R:ACGTCCATCACGCCACAAT
166 56.6 SYBR
TUB[1] tubulin
  • Different temperatures
NA
  • F:TTGCTACAGAACCCTCAAAGTGC
  • R:AGACGTGGGAACGGAACCAT
159 59.2 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yu-Zhou Du
  • Email: yzdu@yzu.edu.cn
  • Institution: School of Horticulture and Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou, Jiangsu, China

Citation Statistics

Cited by 21 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Sun M, Lu MX, Tang XT, Du YZ. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae). PLoS One. 2015 Jan 13;10(1):e0115979. doi: 10.1371/journal.pone.0115979. eCollection 2015. PubMed PMID: 25585250; PubMed Central PMCID: PMC4293147.

Categories