Setaria italica

From ICG
Jump to: navigation, search

Description

Setaria italica.png
  • Setaria viridis is is a species of grass that is a member of the Panicoid family. It is native to Eurasia, but it is known on most continents as an introduced species and is closely related to Setaria faberi. It is a hardy grass which grows in many types of urban, cultivated, and disturbed habitat, including vacant lots, sidewalks, railroads, lawns, and at the margins of fields. It is the wild antecedent of the crop foxtail millet. It is the most economically important family of grass species that has been proposed as a model to study C4 photosynthesis and related bioenergy grasses[1][2].
  • Common Name: Foxtail millet
  • NCBI Taxonomy

Dehydration & Salinity Treatment

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Act2[1] Actin2
  • Salinity treatment
Si026509m
  • F:CGCATATGTGGCTCTTGACT
  • R: GGGCACCTAAATCTCTCTGC
126 60 SYBR
RNA POL II[1] RNA polymerase II
  • Salinity treatment
  • Dehydration stress
Si033113m
  • F: TAGGAAAGGAATTGGCAAGG
  • R: TAGGACTGCTTTCGACCCA
146 60 SYBR
EF-1a [1] Elongation factor 1-alpha
  • Dehydration treatment
Si022039m
  • F:TGACTGTGCTGTCCTCATCA
  • R:GTTGCAGCAGCAAATCATCT
133 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Manoj Prasad
  • Email: manoj_prasad@nipgr.ac.in
  • Institution: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India

Citation Statistics

Cited by 39 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Kumar K, Muthamilarasan M, Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setariaitalica L.) subjected to abiotic stress conditions[J]. Plant Cell, Tissue and Organ Culture (PCTOC), 2013, 115(1): 13-22.
  2. Julia Lambret-Frotté, Leandro C. S. de Almeida, Stéfanie M. de Moura, Flavio L. F. Souza, Francisco S. Validating Internal Control Genes for the Accurate Normalization of qPCR Expression Analysis of the Novel Model Plant Setaria viridis. PLoS One. 2015; 10(8): e0135006.doi: 10.1371/journal.pone.0135006. PMCID: PMC4527663.

Categories