Shiraia bambusicola

From ICG
Jump to: navigation, search

Description

Shiraia bambusicola-1.jpg
  • Shiraia bambusicola is an important and valuable macrofungus in the medical and food industries. It is noteworthy for its hypocrellins, the main secondary metabolites of S. bambusicola, whose use has been proposed for disease treatments that involve anti-clinical strains and antiinflammatory and anti-viral activity [1].
  • Common Name: Unknown
  • NCBI Taxonomy

Various Culture Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SbLAlv9[1] LAlv9 family protein
  • Different light conditions
  • Different media
NA
  • F:TCCCCTCCAACAGCTCGATA
  • R:TGACGAAGCGATGCAGAAGT
159 60 SYBR
SbJsn1[1] RNA binding protein‑like protein Jsn1
  • Different light conditions
  • Different media
NA
  • F:TGCCCAGAAGATCATCGACG
  • R:ACGGCCAAGCATAACCTCAA
175 60 SYBR
SbSAS1[1] GTP‑binding protein SAS1
  • Different light conditions
  • Different media
NA
  • F:GCGATTCAGCGAAGACTCCT
  • R:ATGGTCCTGAAACGCTCCTG
141 60 SYBR
SbVAC55[1] Vacuolar protein sorting 55
  • Different light conditions
  • Different media
NA
  • F:GGCTGTCTTTCGTTCTTGCG
  • R:AAGTCATCCCGGTTAGCTGC
151 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Cheng‑Lin Hou
  • Email: houchenglincn@yahoo.com
  • Institution: College of Life Science, Capital Normal University, Beijing 100048, People’s Republic of China

Citation Statistics

Cited by 1 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Zhang C, Li T, Hou CL, Shen XY. Selection of reference genes from Shiraia bambusicola for RT-qPCR analysis under different culturing conditions. AMB Express. 2017 Dec;7(1):14. doi: 10.1186/s13568-016-0314-9. Epub 2017 Jan 3. PubMed PMID: 28050855; PubMed Central PMCID: PMC5209326.

Categories