Spodoptera exigua

Description

Spodoptera exigua is a widespread and polyphagous lepidopteran pest that causes severe economic damage in both dicotyledon and monocotyledon crops and flower species. It is native to Asia, but has been introduced worldwide and is now found almost anywhere its host crops are grown. The voracious larvae are the main culprits. It has recently become a major economic cotton pest in China, probably due to the reduced pesticide usage attributed to adoption of Bt cotton producing the Cry1Ac protein^[1]^[2].
Common Name: Beet armyworm, Small mottled willow moth
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
L10^[1]	Ribosomal protein L10	Epidermis, head, midgut, fat body and hemolymph	EU258622	F:GGCTACGGTCGACGACTTCCC R:GCAGCCTCATGCGGATGTGGAAC	155	60	EvaGreen
EF2^[1]	Elongation factor 2	Epidermis, head, midgut, fat body and hemolymph	AY078407	F:CTGACCGCGCAACCCAGACT R:CACGAACATGGGGGTACCAGCG	150	60	EvaGreen
L7A^[1]	Ribosomal protein L7A	Epidermis, head, midgut, fat body and hemolymph	EU259814	F:TGAGCTTGTCCTCTTCCTGCCC R:GCTGCACGGTCGCCAGACTC	150	60	EvaGreen
ACT2^[1]	β-actin2	larvae samples for pupae and adults	JF728814	F:GGCTGCCGACATAGACATGCG R:GGGTCCTCCACGCGGATCTT	180	60	EvaGreen
ACT1^[1]	β-actin1	Larvae samples All developmental stage	JF728814	F:AAGCCTTCGATGCCACCGGGTA R:TTCGGGCGTGTTTAGTGGAGGC	170	60	EvaGreen
GAPDH^[1]	Glyceralde hyde-3-phosphate dehydrogen ase	All developmental stage	JF728815	F:CTGAGGAACAGGTCGTGTCATCCGA R:GATCGATAACGCGGTTGGAGTAGCC	150	60	EvaGreen
SOD^[1]	Superoxide dismutase	Females ALl evelopmental stage sample groups	EU263634	F:GCCGTGTGTGTTCTCAAGGGCG R:GCGCCAGCTGACGTGCATCC	170	60	EvaGreen

Name: Xun Zhu
Email: jianhl@mail.hzau.edu.cn
Institution: Laboratory of Pesticide, College of Plant Science & Technology, Huazhong Agricultural University, Wuhan, China

Cited by 40 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Zhu X, Yuan M, Shakeel M, et al. (2014) Selection and evaluation of reference genes for expression analysis using qRT-PCR in the beet armyworm Spodoptera exigua (Hubner) (Lepidoptera: Noctuidae). PLoS One 9, e84730.
↑ Qiu L, Cui SH, Liu L, et al. (2017) Aminopeptidase N1 is involved in Bacillus thuringiensis Cry1Ac toxicity in the beet armyworm, Spodoptera exigua. Scientific Reports 7.