Channa striatus

Description

Channa striata is a species of the fresh water snakehead fish of Channidae family that normally resides in a temperature of 25–27℃. It is native to South and Southeast Asia and have long been regarded as valuable fish in far East. It has also been introduced to some Pacific Islands. Striped snakehead is a obligatory air-breathing carnivorous fish that were once considered a pest or as a means to control unwanted fry and fingerlings production from tilapia or carp in aquaculture ponds.^[1] ^[2].
Common Name: Snakehead murrel,Common snakehead,Chevron snakehead,Striped snakehead
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
tub^[1]	alpha-tubulin	Liver and gill tissues under both short- and long-term thermal stress	KC710731	F:CCTGCTGGGAACTGTATTGT R:TCAATGAGTTCCTTGCCAAT	89	54	SYBR
β-actin^[1]	beta-actin	Liver, gill and lmuscle tissues under both short- and long-term thermal stress	KC967219	F:GCCTTCCTTCCTTGGTATGG R:GTGTTGGCGTACAGGTCCTT	89	59	SYBR
gapdh^[1]	Glyceraldehyde-3-phosphate dehydrogenase	Lmuscle tissues under both short- and long-term thermal stress	KF044311	F:ATCAAGGAAGCGGTGAAGAAGG R:CGAAGATGGAGGAGTGGGTGTC	99	60	SYBR

Name: Sasmita Mohanty
Email: smohanty@kiitbiotech.ac.in
Institution: KIIT School of Biotechnology, KIIT University, Bhubaneswar, Odisha 751024, India

Cited by 8 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Purohit GK, Mahanty A, Mohanty BP, Mohanty S (2016) Evaluation of housekeeping genes as references for quantitative real-time PCR analysis of gene expression in the murrel Channa striatus under high-temperature stress. Fish Physiol Biochem 42, 125-135.
↑ Muntaziana AMP, Amin SMN, Kamarudin MS, Rahim A, Romano N (2017) Feeding frequency influences the survival, growth and body lipid content of striped snakehead, Channa striatus (Bloch) fry. Aquaculture Research 48, 2602-2606.