Solanum lycopersicum

From ICG
Jump to: navigation, search

Description

Solanum lycopersicum.png
  • Solanum lycopersicum is commonly known as a tomato plant, which belongs to the nightshade Solanaceae family. It is originated in Central and South America. The domestication of the tomato and associated selective pressures eventually led to the large-fruited varieties cultivated today. Varieties display considerable variance in fruit colour intensity, shape, and quality[1][2].
  • Common Name: Tomato
  • NCBI Taxonomy

Viral Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Leaf and root tissues subjected to infection of viruses and a viroid
U93208
  • F:ACCACAAATTGCCTTGCTCCCTTG
  • R:ATCAACGGTCTTCTGAGTGGCTGT
110 60 SYBR
UBI[1] Ubiquitin
  • Leaf and root tissues subjected to infection of viruses and a viroid
X58253
  • F:TCGTAAGGAGTGCCCTAATGCTGA
  • R:CAATCGCCTCCAGCCTTGTTGTAA
119 60 SYBR
ACT[1] Actin
  • Leaf and root tissues subjected to infection of viruses and a viroid
BT013707
  • F:AGGCAGGATTTGCTGGTGATGATGCT
  • R:ATACGCATCCTTCTGTCCCATTCCGA
107 60 SYBR
UK[1] Uridylate kinase
  • Leaf and root tissues subjected to infection of viruses and a viroid
AK322232
  • F:TGGTAAGGGCACCCAATGTGCTAA
  • R:ATCATCGTCCCATTCTCGGAACCA
114 60 SYBR
CyP[1] Cyclophilin (peptidyl-prolylcis–trans isomerase)
  • Root samples
AK326854
  • F:CTCTTCGCCGATACCACTCC
  • R:TCACACGGTGGAAGGTTGAG
120 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: FABRIZIO CILLO
  • Email: f.cillo@ba.ivv.cnr.it
  • Institution: Istituto di Virologia Vegetale, CNR, Via Amendola 165/A, 70126 Bari, Italy

Citation Statistics

Cited by 65 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Mascia T, Santovito E, Gallitelli D, et al. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants[J]. Molecular plant pathology, 2010, 11(6): 805-816.
  2. Nicolas Schauer, Dani Zamir, Alisdair R. Fernie; Metabolic profiling of leaves and fruit of wild species tomato: a survey of the Solanum lycopersicum complex. J Exp Bot 2005; 56 (410): 297-307. doi: 10.1093/jxb/eri057

Categories