Solanum tuberosum

From ICG
Jump to: navigation, search

Description

Solanum tuberosum.png
  • Solanum tuberosum L. is a an economically important species of the Solanaceae. It occupies a wide eco-geographical range and is unique among the major world food crops in producing stolons (underground stems) that under suitable environmental conditions swell to form tubers. The tubers are a globally important dietary source of starch, protein, antioxidants and vitamins, serving the plant as both a storage organ and a vegetative propagation system[1][2].
  • Common Name: Potato
  • NCBI Taxonomy

Cold Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ef1a[1] Elongation factor 1-a
  • Tuber tissues
  • Cold storage at different temperatures and treatment periods
AB061263
  • F:ATTGGAAACGGATATGCTCCA
  • R:TCCTTACCTGAACGCCTGTCA
101 60 SYBR
APT[1] Adenine phosphoribosyl transferase
  • Tuber tissues
  • Cold storage at different temperatures and treatment periods
CK270447
  • F:GAACCGGAGCAGGTGAAGAA
  • R:GAAGCAATCCCAGCGATACG
121 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jose Ignacio Ruiz de Galarreta
  • Email: jiruiz@neiker.net
  • Institution: The Basque Institute of Agricultural Research and Development, PO Box 46, E01080 Vitoria, Spain

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-09-01])

Parasitic Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPN7[3] 26S proteasome regulatory subunit
  • Roots Infected with Cyst Nematodes
TC203637(TGI potato TC number)
  • F:TTGGGGTGTCTGAGGATTTC
  • R:CATTCTTTGCATCAGGACGA
123 60 SYBR
UBP22[3] ubiquitin-specific protease 22
  • Roots Infected with Cyst Nematodes
TC212444(TGI potato TC number)
  • F:CAATGCAGCAACGCCAGA
  • R:AGCAGCAGTAGCACCACCAC
98 60 SYBR
OXA1[3] OXA1 protein
  • Roots Infected with Cyst Nematodes
TC204983(TGI potato TC number)
  • F:GCGATTCTGAAGCCAAAACT
  • R:TTGTTGACCTTCAGCCACAG
87 60 SYBR
MST2[3] mercaptopyruvate sulfurtransferase
  • Roots Infected with Cyst Nematodes
TC206257(TGI potato TC number)
  • F:AGTGCAGCTCGTGTATGGTG
  • R:ATCCAGAAGCACGCCATCT
94 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bernard Caromel
  • Email: Bernard.Caromel@avignon.inra.fr
  • Institution: INRA, UR1052 GAFL Génétique et Amélioration des Fruits et Légumes, Domaine Saint Maurice, Allée des Chênes, CS 60094, 84143 Montfavet Cedex, France

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Lopez-Pardo R, de Galarreta J I R, Ritter E. Selection of housekeeping genes for qRT-PCR analysis in potato tubers under cold stress[J]. Molecular breeding, 2013, 31(1): 39-45.
  2. Hijmans, R. J. Global distribution of the potato crop. Am. J. Potato Res. 78, 403–412 (2001).
  3. 3.0 3.1 3.2 3.3 Castro-Quezada, Patricio, et al. "Identification of reference genes for normalizing RNA expression in potato roots infected with cyst nematodes." Plant molecular biology reporter 31.4 (2013): 936-945.

Categories