Sorghum bicolor

Description

Sorghum bicolor, an African grass related to sugar cane and maize, is grown for food, feed, fibre and fuel. Sorghum is a yearly herb in the grasses. The stalks are thick, upright and support roots in the base section. It can be divided into edible sorghum, sugar sorghum, and brush with sorghum. It is more widely cultivated in China, with the largest number of regions in the northeast. Edible sorghum grain is used for consumption and mading wine and the stalks is to make syrup or raw food.^[1] ^[2].
Common Name: Sorghum
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
PP2A^[1]	Serine/threonine-Protein	Salt, cold, water stress, heat, and abscisic acid Leaves, roots, seedlings, panicle, and mature seeds	XM_002453490	F:AACCCGCAAAACCCCAGACTA R:TACAGGTCGGGCTCATGGAAC	138	82.7	SYBR
EIF4α^[1]	Eukaryotic Initiation Factor 4A	Salt, cold, water stress, heat, and abscisic acid Leaves, roots, seedlings, panicle, and mature seeds	XM_00245149	F:CAACTTTGTCACCCGCGATGA R:TCCAGAAACCTTAGCAGCCCA	144	84.8	SYBR

Name: Palakolanu Sudhakar Reddy
Email: p.sudhakarreddy@cgiar.org
Institution: International Crops Research Institute for the Semi-Arid Tropics, Patancheru, India

Cited by 7 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 Sudhakar Reddy P, Srinivas Reddy D, Sivasakthi K, et al. (2016) Evaluation of Sorghum [Sorghum bicolor (L.)] Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization. Front Plant Sci 7, 529.
↑ Paterson AH, Bowers JE, Bruggmann R, et al. (2009) The Sorghum bicolor genome and the diversification of grasses. Nature 457, 551-556.