Sorghum bicolor

From ICG
Jump to: navigation, search

Description

Sorghum bicolor.png
  • Sorghum bicolor, an African grass related to sugar cane and maize, is grown for food, feed, fibre and fuel. Sorghum is a yearly herb in the grasses. The stalks are thick, upright and support roots in the base section. It can be divided into edible sorghum, sugar sorghum, and brush with sorghum. It is more widely cultivated in China, with the largest number of regions in the northeast. Edible sorghum grain is used for consumption and mading wine and the stalks is to make syrup or raw food.[1] [2].
  • Common Name: Sorghum
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PP2A[1] Serine/threonine-Protein
  • Salt, cold, water stress, heat, and abscisic acid
  • Leaves, roots, seedlings, panicle, and mature seeds
XM_002453490
  • F:AACCCGCAAAACCCCAGACTA
  • R:TACAGGTCGGGCTCATGGAAC
138 82.7 SYBR
EIF4α[1] Eukaryotic Initiation Factor 4A
  • Salt, cold, water stress, heat, and abscisic acid
  • Leaves, roots, seedlings, panicle, and mature seeds
XM_00245149
  • F:CAACTTTGTCACCCGCGATGA
  • R:TCCAGAAACCTTAGCAGCCCA
144 84.8 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Palakolanu Sudhakar Reddy
  • Email: p.sudhakarreddy@cgiar.org
  • Institution: International Crops Research Institute for the Semi-Arid Tropics, Patancheru, India

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Sudhakar Reddy P, Srinivas Reddy D, Sivasakthi K, et al. (2016) Evaluation of Sorghum [Sorghum bicolor (L.)] Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization. Front Plant Sci 7, 529.
  2. Paterson AH, Bowers JE, Bruggmann R, et al. (2009) The Sorghum bicolor genome and the diversification of grasses. Nature 457, 551-556.

Categories