All public logs
Jump to navigation
Jump to search
Combined display of all available logs of ICG. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)- 16:07, 3 February 2021 Xysj2012 talk contribs deleted page Спорт Спорт Новости Спортивные Новости Sport Sporting Sport Sport Новости Спорта (content was: "спортивное снаряжение это специальные предметы, необходимые для...", and the only contributor was "HungSnider92" (talk))
- 01:37, 21 August 2017 Xysj2012 talk contribs deleted page Test3 (content was: "{{DNA| SOURCE = human eif | DNA = ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCC GCCGCCAGCTCACCATGGATGATGAT...", and the only contributor was "Xysj2012" (talk))
- 14:10, 20 August 2017 Xysj2012 talk contribs deleted page Test2 (content was: "<html> <iframe frameborder=0 width=1000 height=300 marginheight=0 marginwidth=0 scrolling=yes src=http://192.168.72.232/00-Test/ICG...", and the only contributor was "Xysj2012" (talk))
- 08:58, 15 August 2017 Xysj2012 talk contribs deleted page BLAST (content was: " {|class="wikitable sortable" style="font-size:12pt; width:100%" |- ! Literature ! Species ! Publication Year |- | *Validation...", and the only contributor was "Xysj2012" (talk))
- 12:48, 13 August 2017 Xysj2012 talk contribs deleted page Test6 (content was: "<html> <iframe frameborder=0 width=1000 height=680 marginheight=0 marginwidth=0 scrolling=yes src=http://127.0.0.1/00-Test/phpweb/0...", and the only contributor was "Xysj2012" (talk))
- 12:41, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Species.png
- 03:33, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Gene Ontology 1.png
- 03:33, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Experiment Ontology 1.png
- 03:30, 13 August 2017 Xysj2012 talk contribs uploaded File:Experiment Ontology 1.png
- 03:28, 13 August 2017 Xysj2012 talk contribs uploaded File:Gene Ontology 1.png
- 03:04, 13 August 2017 Xysj2012 talk contribs uploaded File:Species 1.png
- 11:54, 12 August 2017 Xysj2012 talk contribs uploaded File:Species.png
- 10:41, 12 August 2017 Xysj2012 talk contribs uploaded a new version of File:Gene Ontology.png
- 10:40, 12 August 2017 Xysj2012 talk contribs uploaded a new version of File:Experiment Ontology.png
- 10:37, 12 August 2017 Xysj2012 talk contribs uploaded File:Experiment Ontology.png
- 10:36, 12 August 2017 Xysj2012 talk contribs uploaded File:Gene Ontology.png
- 08:26, 12 August 2017 Xysj2012 talk contribs deleted page Category:RPSA (content was: "*RPSA", and the only contributor was "ICG Expert4" (talk))
- 10:57, 11 August 2017 Xysj2012 talk contribs uploaded File:Eif 1.png
- 06:44, 11 August 2017 Xysj2012 talk contribs deleted page Gene:RPSA (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous ! Application scenarios ! Publication ! Year |} =='''''Externa...")
- 06:33, 11 August 2017 Xysj2012 talk contribs uploaded File:RPL.png
- 04:20, 11 August 2017 Xysj2012 talk contribs uploaded File:AP1.png
- 04:18, 11 August 2017 Xysj2012 talk contribs uploaded a new version of File:AP.png
- 04:18, 11 August 2017 Xysj2012 talk contribs deleted page File:AP.png (Deleted old revision 20170811041821!AP.png)
- 04:18, 11 August 2017 Xysj2012 talk contribs uploaded a new version of File:AP.png
- 02:23, 11 August 2017 Xysj2012 talk contribs deleted page Category:MiRNA (content was: "* miRNA")
- 14:07, 10 August 2017 Xysj2012 talk contribs deleted page Category:SF3A1 (content was: "*SF3A1", and the only contributor was "ICG Expert4" (talk))
- 14:04, 10 August 2017 Xysj2012 talk contribs deleted page Category:EF2 (content was: "*EF2", and the only contributor was "ICG Expert4" (talk))
- 14:02, 10 August 2017 Xysj2012 talk contribs deleted page Category:U2AF (content was: "*U2AF", and the only contributor was "ICG Expert4" (talk))
- 14:01, 10 August 2017 Xysj2012 talk contribs deleted page Category:EF4 (content was: "*TPC2L", and the only contributor was "ICG Expert4" (talk))
- 10:40, 10 August 2017 Xysj2012 talk contribs uploaded File:ARM.png
- 01:53, 10 August 2017 Xysj2012 talk contribs moved page Oak to Cork oak without leaving a redirect
- 08:00, 9 August 2017 Xysj2012 talk contribs uploaded File:Human EF1A.png
- 07:56, 9 August 2017 Xysj2012 talk contribs uploaded File:Sedum tublin.png
- 05:25, 8 August 2017 Xysj2012 talk contribs deleted page Category:EF1γ (content was: "*EF1γ", and the only contributor was "ICG Expert4" (talk))
- 05:21, 8 August 2017 Xysj2012 talk contribs deleted page Category:B3M (content was: "*B3M", and the only contributor was "ICG Expert4" (talk))
- 05:20, 8 August 2017 Xysj2012 talk contribs deleted page Category:SnoR23 (content was: "*SnoR23", and the only contributor was "ICG Expert4" (talk))
- 05:35, 7 August 2017 User account Yang Zhang talk contribs was created by Xysj2012 talk contribs
- 05:39, 5 August 2017 Xysj2012 talk contribs moved page Gene:EF1α to Gene:EF1A without leaving a redirect
- 02:55, 5 August 2017 Xysj2012 talk contribs deleted page Gene:EF4 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 14:00, 4 August 2017 Xysj2012 talk contribs deleted page Gene:MiR-22a (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 11:12, 4 August 2017 Xysj2012 talk contribs deleted page Category:MiR-23a (content was: "*MiR-23a", and the only contributor was "ICG Expert4" (talk))
- 11:12, 4 August 2017 Xysj2012 talk contribs deleted page Category:MiR-22a (content was: "*MiR-22a", and the only contributor was "ICG Expert4" (talk))
- 11:11, 4 August 2017 Xysj2012 talk contribs deleted page Category:Mi167 (content was: "*Mi167", and the only contributor was "ICG Expert4" (talk))
- 11:09, 4 August 2017 Xysj2012 talk contribs deleted page Gene:MiR-23a (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 11:05, 4 August 2017 Xysj2012 talk contribs deleted page Category:Mi159 (content was: "*Mi159", and the only contributor was "ICG Expert4" (talk))
- 11:05, 4 August 2017 Xysj2012 talk contribs deleted page Gene:Mi159 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 11:04, 4 August 2017 Xysj2012 talk contribs deleted page Gene:Mi167 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 11:00, 4 August 2017 Xysj2012 talk contribs deleted page Gene:SnoR23 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 10:59, 4 August 2017 Xysj2012 talk contribs moved page Category:Category:Small RNAs to Category:Small RNAs without leaving a redirect
- 10:59, 4 August 2017 Xysj2012 talk contribs moved page Category:SnoR14 to Category:Category:Small RNAs without leaving a redirect