Sus scrofa

From ICG
Jump to: navigation, search

Description

Sus scrofa.png
  • Sus scrofa L. is a species that is utilised for food and sport hunting throughout the world. It can be described as a mammal and generalist omnivore, which is able to vary its diet. It has broad geographic distributions that include semi deserts, wetlands, high mountain environments and forest ecosystems. Translocations by humans have spread this species across the world[1][2][3]
  • Common Name: Wild boar
  • NCBI Taxonomy

Spermatozoa Cryopreservation

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Different concentrations of cryoprotectants
DQ178124
  • F:ACTCACTCTTCTACCTTTGATGCT
  • R:TGTTGCTGTAGCCAAATTCA
100 59.0 SYBR
RPL4[1] Ribosomal protein L4
  • Different concentrations of cryoprotectants
DQ845176
  • F:AGGAGGCTGTTCTGCTTCTG
  • R:TCCAGGGATGTTTCTGAAGG
185 60 SYBR
PPIA[1] Peptidylprolyl isomerase A
  • Different concentrations of cryoprotectants
NM_214353
  • F:CACAAACGGTTCCCAGTTTT
  • R:TGTCCACAGTCAGCAATGGT
171 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Changjun Zeng
  • Email: zengchj@sicau.edu.cn
  • Institution: College of Animal Science and Technology, Sichuan Agricultural University, Ya’an, Sichuan 625014, PR China

Citation Statistics

Cited by 21 (Based on Google Scholar [2017-09-01])

Actinobacillus pleuropneumoniae Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • Tissues and blood infected with Actinobacillus pleuropneumoniae
TC162668
  • F:ACCCAGAAGACTGTGGATGG
  • R:AAGCAGGGATGATGTTCTGG
NA 62 AmpliQ

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kerstin Skovgaard
  • Email: kis@vet.dtu.dk
  • Institution: Department of Veterinary Diagnostics and Research, National Veterinary Institute, Technical University of Denmark, Bu¨lowsvej 27, DK-1790 Copenhagen, Denmark

Citation Statistics

Cited by 31 (Based on Google Scholar [2017-09-01])

Oocytes & Preimplantation Embryos

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[3] Glyceraldehyde 3-phosphate dehydrogenase
  • Early porcine embryonic development
AF017079
  • F:TCGGAGTGAACGGATTTG
  • R:CCTGGAAGATGGTGATGG
219 51.1 SYBR
PGK1[3] Phosphoglycerate kinase 1
  • Early porcine embryonic development
AY677198
  • F:AGATAACGAACAACCAGAGG
  • R:TGTCAGGCATAGGGATACC
126 56.4 SYBR
S18[3] 18S ribosomal RNA
  • Early porcine embryonic development
NR_002170
  • F:GGCTACCACATCCAAGGAAG
  • R:TCCAATGGATCCTCGCGGAA
149 58.7 SYBR
UBC[3] Poly-ubiquitin
  • Early porcine embryonic development
M18159
  • F:TTCGTGAAGACCTTGACTG
  • R:GGACTCCTTCTGGATGTTG
186 51.1 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bernard AJ Roelen
  • Email: b.a.j.roelen@vet.uu.nl
  • Institution: Department of Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, 3584 CM Utrecht, The Netherlands

Citation Statistics

Cited by 119 (Based on Google Scholar [2017-09-01])

Gastrointestinal Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[4] Beta-2-microglobulin
  • Liver
  • Ileum
  • Colon
  • All treatment groups
  • Entire data set
NM_213978
  • F:CGGAAAGCCAAATTACCTGAAC
  • R:TCTCCCCGTTTTTCAGCAAAT
83 59~60 SYBR
GAPDH[4] Glyceraldehyde 3-phosphate dehydrogenase
  • Liver
  • All treatment groups
  • Entire data set
AF017079
  • F:CAGCAATGCCTCCTGTACCA
  • R:ACGATGCCGAAGTTGTCATG
72 58 SYBR
PPIA[4] Peptidylprolyl isomerase A
  • Ileum
  • Colon
NM_214353
  • F:CGGGTCCTGGCATCTTGT
  • R:TGGCAGTGCAAATGAAAAACTG
75 56.5~58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: T. Sweeney
  • Email: Marion.Ryan@ucd.ie
  • Institution: School of Agriculture, Food Science and Veterinary Medicine, University College Dublin, Ireland

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPL4[5] Ribosomal protein L4
  • 21 consecutive days of heat stress except on day 21
DQ845176
  • F:GCTCTATGGCACTTGGCGT
  • R:GCGGAGGGCTCTTTGGAT
124 55 iCycler IQ Real-Time PCR Detection System (Bio-Rad)
TBP[5] TATA-box-binding protein
  • 21 consecutive days of heat stress except on day 21
DQ845178
  • F:GTAGTTATGAGCCAGAGT
  • R:CCTTTAGGATAGGGTAG
159 55 iCycler IQ Real-Time PCR Detection System (Bio-Rad)
B2M[5] Beta-2-microglobulin
  • 23 consecutive days of heat stress
NM_213978
  • F:TATCTGGGTTCCATCCG
  • R:AACTATCTTGGGCTTATCG
197 55 iCycler IQ Real-Time PCR Detection System (Bio-Rad)

Molecular types

  • mRNA

Evaluation Methods

Contact

  • Name: Liao Ming
  • Email: mliao@scau.edu.cn
  • Institute: The South China Agricultural University, Key Laboratory of Animal Disease Control and Prevention, Ministry of Agriculture, College of Veterinary Medicine, Guangzhou 510642, China

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Zeng C, He L, Peng W, et al. Selection of optimal reference genes for quantitative RT-PCR studies of boar spermatozoa cryopreservation[J]. Cryobiology, 2014, 68(1): 113-121.
  2. 2.0 2.1 Skovgaard K, Mortensen S, Poulsen K T, et al. Validation of putative reference genes for qRT-PCR normalization in tissues and blood from pigs infected with Actinobacillus pleuropneumoniae[J]. Veterinary immunology and immunopathology, 2007, 118(1): 140-146.
  3. 3.0 3.1 3.2 3.3 3.4 Kuijk E W, du Puy L, van Tol H T A, et al. Validation of reference genes for quantitative RT-PCR studies in porcine oocytes and preimplantation embryos[J]. BMC Developmental Biology, 2007, 7(1): 58.
  4. 4.0 4.1 4.2 Ryan M T, Collins C B, O'Doherty J V, et al. Selection of stable reference genes for quantitative real-time PCR in porcine gastrointestinal tissues[J]. Livestock Science, 2010, 133(1): 42-44.
  5. 5.0 5.1 5.2 Xiang-Hong J, Yan-Hong Y, Han-Jin X, et al. Selection of reference genes for gene expression studies in PBMC from Bama miniature pig under heat stress[J]. Veterinary immunology and immunopathology, 2011, 144(1): 160-166.

Categories