Symbiodinium

From ICG
Jump to: navigation, search

Description

Symbiodinium.png
  • Symbiodinium is a genus of phototrophic, peridin-containing dinoflagellates that live as endosymbionts (zooxanthellae) in a wide variety of tropical marine invertebrates. Symbiodinium is responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla. The genus Symbiodinium encompasses eight lineages (clades A–H), and multiple sub-clade types. Symbiodinium in clades A, B, C, and D are most commonly associated with metazoan hosts while clades C, D, F, G, and H with large soritid foraminifera[1][2].
  • Common Name: Zoox, Zooxanthellae
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Rp-S4 [1] Ribosomal protein S4
  • Thermal stress
EH036413
  • F:CCGCACAAACTGCGTGAGT
  • R:CGCTGCATGACGATCATCTT
101 58~59 SYBR
SAM[1] S-adenosyl-L-methionine synthetase
  • Thermal stress
EH036622
  • F:GCCTACATTTGCCGACAGATG
  • R:AATGGCTTGGCAACACCAAT
101 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ove Hoegh-Guldberg
  • Email: n.rosic@uq.edu.au
  • Institution: Global Change Institute, University of Queensland, St. Lucia, Brisbane 4072( QLD, Australia

Citation Statistics

Cited by 49 (Based on Google Scholar [2017-09-01])

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
pcna[3] Proliferating cell nuclear antigen
  • Cryopreservation
NA
  • F:GAGTTTCAGAAGATTTGCCGAGAT
  • R:ACATTGCCACTGCCGAGGTC
113 60 SYBR
ps1[3] Photosystem I (subunit III)
  • Cryopreservation
NA
  • F:GTGGAGTTGACATTGACTTGGA
  • R:TGCTGCTTGGTGGTCTTGTA
136 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Chiahsin Lin
  • Email: chiahsin@nmmba.gov.tw
  • Institution: Institute of Marine Biology, National Dong Hwa University

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-08-10])

References

  1. 1.0 1.1 1.2 Rosic N N, Pernice M, Rodriguez-Lanetty M, et al. Validation of housekeeping genes for gene expression studies in Symbiodinium exposed to thermal and light stress[J]. Marine biotechnology, 2011, 13(3): 355-365.
  2. Pochon X, Gates RD. A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai'i. Mol Phylogenet Evol. 2010 Jul;56(1):492-7. doi: 10.1016/j.ympev.2010.03.040. Epub 2010 Apr 4. PMID: 20371383 DOI: 10.1016/j.ympev.2010.03.040.
  3. 3.0 3.1 Chong, Gabriella, et al. "Validation of reference genes for cryopreservation studies with the gorgonian coral endosymbiont Symbiodinium." Scientific reports 7 (2017): srep39396.

Categories